Skip main navigation
Close Drawer MenuOpen Drawer Menu
×

Acetylcholine Release in Human Heart Atrium

Influence of Muscarinic Autoreceptors, Diabetes, and Age
Originally published27 Mar 2001https://doi.org/10.1161/01.CIR.103.12.1638Circulation. 2001;103:1638–1643

    Abstract

    Background—An imbalance of sympathetic and parasympathetic drive to the heart is an important risk factor for cardiac death in patients with coronary heart disease, diabetes, and renal insufficiency. The amount of neurotransmitter released from peripheral autonomic nerves is modulated by presynaptic receptor systems. In analogy to α-autoreceptors on sympathetic nerves, muscarinic autoreceptors activated by endogenous acetylcholine may exist on parasympathetic nerves in the human heart.

    Methods and Results—We developed a technique to study acetylcholine release from human atria and investigated muscarinic autoreceptor function. A pharmacological and molecular approach was used to characterize the subtype involved. Of the 5 muscarinic receptor subtypes cloned, only mRNA encoding for M2- and M3-receptors were detected. Potencies of several muscarinic antagonists against the release-inhibiting effect of the nonselective muscarinic agonist carbachol at the cardiac autoreceptor were correlated with published data for human cloned M1- through M5-receptors.

    Conclusions—This analysis clearly indicates that acetylcholine release in human atria is controlled by muscarinic M2-receptors. Blockade of these receptors by atropine doubles the amount of acetylcholine released at a stimulation frequency of 5 Hz. In atria of patients >70 years of age and patients with late diabetic complications, acetylcholine release is reduced. Locally impaired cardiac acetylcholine release may therefore represent a pathophysiological link to sudden cardiac death in elderly and diabetic patients.

    Sympathetic overactivity plays a dominant prognostic role in myocardial infarction and heart failure of various causes, and the role of enhanced cardiac norepinephrine release is well described. Surprisingly, little is known about the role of the cholinergic nervous system, which is considered to be a functional counterpart of sympathetic influences to the heart.1 Parasympathetic activity is suppressed in heart failure,2 diabetes,3 and old age,4 and an imbalance of sympathetic and parasympathetic drive may contribute to the high incidence of sudden cardiac death in these patients. This view is mainly based on indirect measures of cardiac parasympathetic dysfunction such as altered heart rate variability5 and baroreflex sensitivity6 ; however, nothing precise is known about presynaptic mechanisms controlling cardiac acetylcholine release in humans. Parasympathetic nerve endings may have presynaptic receptors, which when activated inhibit acetylcholine release.789 The most important presynaptic receptor systems are those activated by endogenous ligands. In analogy to presynaptic α-autoreceptors on sympathetic nerve terminals,10 muscarinic autoreceptors activated by neuronally released acetylcholine may exist on parasympathetic nerves in the human heart. The existence of presynaptic muscarinic autoreceptors may explain the clinical observation of why low doses of the M1-selective antagonist pirenzipine decrease heart rate in humans.11 Five human muscarinic receptors (M1 through M5) have been cloned,12 and one could hypothesize that presynaptic and postsynaptic receptor subtypes differ. Therefore, we determined the muscarinic autoreceptor subtype of parasympathetic nerves regulating acetylcholine release in the human heart and investigated whether diabetes or old age modifies acetylcholine release.

    Methods

    Patients and Tissue Sources

    The study was approved by the Ethics Committee of the University of Freiburg. Atrial tissues were taken from patients undergoing open heart surgery for coronary bypass grafting (78 patients) or aortic valve replacement (18 patients). Specimens of ≈100 to 200 mg were harvested from the tip of the right auricle during venous cannulation for extracorporal circulation. The age of the patients (21 women; 75 men) averaged 67±1 years (range, 41 to 82). Patients with diabetes were separated into groups according to the presence (10 patients) or absence (8 patients) of diabetic complications (nephropathy, polyneuropathy, and retinopathy). Diabetic nephropathy was assumed in diabetic patients with a serum creatinine of ≥1.2 mg/dL and pathological microalbuminuria (>30 mg/24 h) or overt proteinuria (>300 mg/24 h). Diagnosis of retinopathy and polyneuropathy was based on diagnosed typical findings of funduscopy and neurological examination, respectively.

    Release Experiments

    Connective tissue was removed and multiple segments were prepared. Segments were incubated with [3H]-choline (25 μCi, 0.31 nmol) between platinum electrodes in Krebs-Henseleit solution gassed with 95% O2 /5% CO2. During incubation (75 minutes), field stimulation (40 V, 20 mA, 2 ms) was applied every 5 seconds to increase uptake of radioactivity.13 The segments were then placed into superfusion chambers (volume, 250 μL). Eight segments were superfused (2 mL/min) in parallel at 37°C. Hemicholine (3 μmol/L) was added after 65 minutes to prevent reuptake of [3H]-choline. After washout, twenty 3-minute fractions of the superfusion solution were collected. Two stimulations (40 mA, 5 Hz, 2 minutes) were applied (S1 at 7 minutes, S2 at 45 minutes after start of collections). S1 served as reference stimulation. The effect of drugs was tested by adding them 15 minutes before S2. In those experiments in which a drug was present in both stimulation periods (throughout), it was added 15 minutes before S1.

    Estimation of Radioactivity

    The radioactivity of the 3-minute samples was detected by liquid scintillation counting. Total tissue radioactivity was determined at the end of each experiment after the tissue was dissolved in Soluene (Packard).

    Calculation of Results

    The spontaneous outflow of radioactivity was determined as the mean of radioactivity of 2 samples, collected before and after electrical stimulation. The stimulation-induced (S-I) outflow of radioactivity was calculated by subtracting the spontaneous outflow of radioactivity from the radioactivity present in the three 3-minute samples collected immediately after onset of stimulation (Figure 1). S-I outflow of radioactivity is subsequently expressed as a percentage of the total tissue content of radioactivity at the time of stimulation (fractional S-I outflow in S1 and S2; FR1, FR2). When effects of drugs were tested, results were calculated as FR2 to FR1 ratios and expressed as percentages of the corresponding controls. Antagonist potencies (pKB values) were estimated according to Equation 4 of Furchgott.14

    Statistics

    All data are expressed as mean±SEM. Data points were always determined in duplicate; n gives the number of atria used in each group. Data were analyzed by unpaired Student’s t test or ANOVA where appropriate. Values of P<0.05 were considered statistically significant.

    RNA Extraction and Reverse Transcription–Polymerase Chain Reaction

    Atrial tissue was homogenized and total RNA was isolated from the supernatant with the RNeasy Kit (Quiagen). DNA was isolated by the same method with RNAase instead of DNAse. cDNA synthesis and reverse transcription–polymerase chain reaction (RT-PCR) were performed at 57°C and 35 cycles with the SuperScript preamplification system (GIBCO BRL). Homologous primers for human M1- through M5-receptors were used (Table 1). RT-PCR products were analyzed by electrophoretic separation. For negative control, RT-PCR performed without reverse transcriptase was used. Primer efficiency with genomic DNA was performed under the same conditions. PCR products were cloned in the pCR2.1-TOPO plasmide with the TOPO-TA cloning kit (Invitrogen) and sequenced at the Human Genetic Institute (Freiburg, Germany). Sequences were verified by BLAST search at the National Center for Biotechnology Information.

    Drugs and Vehicles

    Krebs-Henseleit solution (mmol/L) contained NaCl 118, KCl 4.7, CaCl2 2.5, MgCl2 0.45, NaHCO3 25, KH2PO4 1.03, d-(+)-glucose 11.1, disodium-EDTA 0.067, and ascorbic acid 0.07. The following drugs were used: [3H]-choline (Amersham); atropine, pirenzepine, himbacine, TTX, EGTA, and carbachol (all Sigma); tropicamide and AFDX-116 (Tocris); and hemicholinum (ICI Chemicals). Drugs were dissolved with either distilled water, DMSO, or ethanol.

    Results

    [3H]-Acetylcholine Release From Human Atria

    Human atrial segments incubated with [3H-choline] accumulated 33 140±1170 dpm per milligram of tissue wet weight. Electrical field stimulation with 600 pulses at 5 Hz (Figure 1) induced an increase of the fractional outflow of radioactivity of 0.27±0.02% (n=49). Fractional outflow in the two stimulation periods (S1, S2) was stable (Figure 1), with a ratio (FR2/FR1) of 89±2.1% (n=49). Tetrodotoxin (1 μmol/L) and omission of Ca2+ abolished the release of S-I radioactivity (Figure 1). Thus, the S-I release of radioactivity from human atrial tissue could be taken as an index of [3H]-acetylcholine release, as shown previously for other species.9

    Modulation of Acetylcholine Release by Muscarinic Autoreceptors in Human Atria

    The nonselective muscarinic agonist carbachol (0.1 to 10 μmol/L) inhibited the release of radioactivity concentration dependently (EC50 of 0.9 μmol/L) and at a maximum of 78% (Figure 2). Atropine (0.1 μmol/L), a nonselective muscarinic antagonist, when present throughout superfusion, shifted the dose-response curve of carbachol to the right (Figure 2). Atropine by itself enhanced the release of radioactivity dose dependently. To further characterize the receptor subtype involved, dissociation constants (pKB values) of 5 muscarinic antagonists were determined (Table 2) against carbachol and plotted against affinity estimates of cloned human muscarinic receptors. Whenever possible, pKB values1516 were taken for correlation. In the case that pKB values were not available, pKi values were used instead.1718 There was a significant correlation for the M2- and M4-receptors, with the best correlation coefficient calculated for the M2-receptor (Figure 3). This view is supported by the rank order of potencies: atropine>himbacine>AFDX-116≥tropicamide>pirenzepine, compatible with the involvement of an M2 receptor.

    RT-PCR of Muscarinic Receptors in Human Atria

    Under the conditions applied, only significant mRNA levels of M2- and M3-receptor subtypes were found (Figure 4). The M2-receptor band was more prominent than the M3-receptor band. RT-PCR without reverse transcriptase (−RT; Figure 4) showed that the RT-PCR products obtained originated from mRNA. PCR of genomic DNA revealed bands for 5 muscarinic receptors (data not shown), proving the specificity of the primers.

    Influence of Age and Late Diabetic Complications on Acetylcholine Release From Human Atria

    Uptake of radioactivity after incubation with [3H]-choline was similar in all age groups (Figure 5). However, S-I release of [3H]-acetylcholine decreased with age. Segments of patients >70 years of age showed a lower release of [3H]-acetylcholine than atria of patients ≤70 years of age. Uptake of radioactivity after incubation with [3H]-choline was similar in patients with or without diabetes but lower in diabetic patients with late complications (Figure 6). Atrial segments of patients with late diabetic complications also had a significant lower fractional release of [3H]-acetylcholine than control subjects and diabetic patients without late complications (Figure 6). The average age of the 3 groups was not different (63±3, 68±2, and 66±1 years).

    Discussion

    A suppressed parasympathetic nervous system of the heart may play an important role for prognosis in diseases such as heart failure, myocardial infarction, and diabetes. In this study, we established a method to investigate acetylcholine release and its modulation by inhibitory muscarinic autoreceptors from human cardiac tissue. Because there was indirect evidence to suggest an impaired release of acetylcholine release in old age11 and diabetes,19 we took advantage of our technique to look into this matter.

    Acetylcholine Release From Human Atria

    Labeling of the cholinergic transmitter stores with [3H]-choline taken up by cholinergic nerves and synthesized to [3H]-acetylcholine by choline acetyltransferase has been used in atrial tissue of guinea pigs, rats, and mice202122 but not in atrial tissue of humans. We modified this technique for human atria and showed a significant outflow of [3H] activity in response to electrical field stimulation. Within 1 hour after obtaining the tissue in the operation theater, experiments were started, which then lasted for ≈3 hours. This short time interval makes it unlikely that effects of denervation may have altered uptake and release functions of parasympathetic nerve endings. The S-I release of radioactivity was completely tetrodotoxin sensitive and dependent on extracellular Ca2+, fulfilling the criteria of exocytotic release processes. Therefore, the S-I outflow of radioactivity from human atria preincubated with [3H]-choline was taken as an index of endogenous acetylcholine release.

    Characterization of Cardiac Inhibitory Autoreceptor

    The amount of acetylcholine released at parasympathetic neuroeffector junctions in the heart is primarily regulated by the central nervous system integrating afferent inputs from the baroreceptor reflex and cardiopulmonary mechanoreceptors and chemoreceptors. However, postganglionic cholinergic nerve endings have presynaptic receptors, which, when activated by endogenous acetylcholine, inhibit the release of cardiac acetylcholine. In several animal species, such muscarinic autoreceptors have been demonstrated in cardiac tissue. These receptors involved in autoinhibition of acetylcholine release are of the M1-subtype in chicken heart7 and of the M2-subtype in guinea pig, rat, and rabbit heart.789 Functional studies suggest the existence of presynaptic M1-receptors in humans. It was postulated that the decrease of heart rate by low concentrations of the preferential M1-receptor antagonist pirencepine is due to blockade of presynaptic M1-receptors enhancing acetylcholine release.11 However, binding studies revealed only the existence of M2-receptors in the human heart.23 To clarify this situation, we used two different approaches: pharmacological characterization with Equation 4 of Furchgott14 and molecular characterization with RT-PCR. First, potencies (pKB values) of 5 muscarinic receptor antagonists against the release-inhibiting effect of the nonselective agonist carbachol were determined and compared with pKB/pKi values of cloned human muscarinic receptors.15161718 The highest correlation coefficient of 0.98 was determined for the M2-subtype, and the slope of the regression was close to unity. pKB values obtained for human autoreceptors were 10-fold lower than those for the cloned receptors. This difference is expected because in our study, the antagonists used had to compete with carbachol and endogenous acetylcholine for the presynaptic autoreceptor. The role of endogenous acetylcholine activating presynaptic autoreceptors is clearly demonstrated by the marked enhancement of acetylcholine release induced by atropine. Taken together, the pharmacological characterization suggests the involvement of presynaptic autoreceptor of the M2- but not the M1-subtype in human atria. This is in accordance with a previous study in human trachea.24 In contrast, at parasympathetic ganglia, the M1-subtype,25 in urinary bladder the M3-subtype26 and in detrusor the M4-subtype, has been described to modulate acetylcholine release.27

    Pharmacological characterization may lead to a false interpretation because of imperfect specificity of muscarinic receptor antagonists available. However, the operation of cardiac muscarinic M2-autoreceptors is supported by results with RT-PCR. With the use of homologous primers, RT-PCR amplified only cDNA encoding for M2- and M3-receptor subtypes. The detection of RT-PCR products for M2-receptors fits well with our pharmacological characterization. However, it is likely that the RT-PCR signal for M2-receptors comes to some extent from mRNA encoding for postsynaptic M2-receptors. M3-receptors have as yet not been found in human heart, but there were some indications from in vitro and in vivo studies that an additional muscarinic receptor, different from the M2-subtype, may exist in human heart.11 M3-receptors have already been demonstrated in chicken28 and dog heart.29 However, our pharmacological analysis excludes presynaptic M3-receptors in human atria. M1-, M4-, and M5-receptors were excluded by RT-PCR. With the pharmacological and molecular evidence taken together, it is feasible that in the human heart, acetylcholine release is modulated exclusively by M2-autoreceptors.

    Influence of Age and Late Diabetic Complications

    The physiological process of aging as well as advanced stages of diabetes have been associated with profound changes in autonomic function. In older age, circulating plasma norepinephrine levels are increased.3031 More recently, an imbalance between sympathetic and parasympathetic influences to the heart in diabetes and old age have been suggested on the basis of heart rate variability studies.5 This dysregulation may be due to defective afferent and efferent signaling processes; however, in addition, alterations of local presynaptic release mechanisms of acetylcholine may be involved. It has already been shown that muscarinic receptor density and function are decreased in old age.11 The concept of a locally altered parasympathetic nervous function is now supported by the present in vitro study, which demonstrates that cardiac acetylcholine release from parasympathetic nerves is decreased in diabetes and old age. As for diabetes, this impairment was observed only in patients with advanced stages of the disease (nephropathy, retinopathy, neuropathy). This fits well with a study in diabetic impotent men, which showed that synthesis and release of acetylcholine in corporeal tissue was reduced and worsened with the duration of diabetes.32 Furthermore, animal studies investigating acetylcholine release from phrenic nerve terminals33 and brain slices34 in streptozotocin-induced diabetes in rats support the concept of locally altered parasympathetic regulation in diabetes. In the present study, the uptake of [3H]-choline was reduced in atria of diabetic patients with late complications. This may reflect a reduced density of parasympathetic innervation or reduced ability of [3H]-acetylcholine generation. However, fractional release calculated as a percentage of the total accumulated tissue radioactivity was also diminished, suggesting an additional functional component. This appears to be true also for atria of patients >70 years of age. Uptake of [3H]-choline was similar to atria of younger patients; however, S-I release of acetylcholine was reduced. One possible explanation is that presynaptic M2-autoreceptor function is upregulated, leading to reduced acetylcholine release, as shown for rat diabetic lungs.35 Taken together, this is the first evidence to show impaired cardiac acetylcholine release in diabetics and elderly people. This impaired local parasympathetic activity may be an important risk factor for sudden cardiac death in these groups of patients. Furthermore, alterations of presynaptic modulation of acetylcholine release must be taken into account when interpreting results of heart rate variability studies, in which pharmacological manipulations are used to assess vagal activity.

    Drs Oberhauser and Schwertfeger contributed equally to this work.

    Figure 1.

    Figure 1. Fractional outflow of radioactivity (%) from human atrial segments preincubated with [3H]-choline and influence of tetrodotoxin (TTX) and omission of Ca2+. There were 2 electrical field stimulations (600 pulses, 5 Hz). A, Time course for control experiments (n=49); B, mean±SEM for control experiments and experiments, in which tetrodotoxin (1 μmol/L; n=6) was added to or Ca2+ (n=8) omitted from superfusion after sample 8. *Significant difference from control (Student’s t test, P<0.05).

    Figure 2.

    Figure 2. Effect of atropine on fractional S-I outflow of [3H]-acetylcholine from human atrial segments preincubated with [3H]-choline and its interaction with carbachol. A, Effect of atropine (n=8), and B, of carbachol alone (n=8) and its interaction with atropine (0.1 μmol/L) (n=8). Data are mean±SEM. Results (FR1/FR2) are expressed as percentages of ratios obtained in corresponding control experiments. *Significant difference from control (Student’s t test, P<0.05). +Significant inhibition of carbachol effect by atropine (ANOVA, P<0.05).

    Figure 3.

    Figure 3. Correlation of antagonist potencies (pKB values) at muscarinic human cardiac autoreceptors and affinity estimates (pKB, pKi values) of cloned human muscarinic receptors.17181920 pKB values at autoreceptors were estimated according to Reference 14 by their ability to shift dose-response curve of carbachol. Data are mean±SEM of 8 to 10 segments. ***Significant correlation for M2-receptor (P<0.001). *Significant correlation for M4-receptor (P<0.05).

    Figure 4.

    Figure 4. Muscarinic receptor subtype expression in human atria analyzed by RT-PCR. PCR with RT (+ RT) run alongside weight marker showed mRNA encoding for M2- and M3-receptors. Negative control (−RT) showed no amplification products.

    Figure 5.

    Figure 5. Influence of age on uptake of [3H]-choline and fractional release of [3H]-acetylcholine from human atrial segments. A, Uptake of radioactivity after incubation with [3H]-choline; B, S-I release of [3H]-acetylcholine in absence of drugs given as percentage of total tissue radioactivity present at time of stimulation (FR in %). Data are mean±SEM. Patient mean age: ≤60 years, 56±1 (13 patients); 61 to 70 years, 65±1 (17 patients), and ≥71 years, 76±1 (19 patients). None had evidence of diabetes. *Significant difference between patients >70 years and patients <61 years of age. +Significant difference between patients >70 years and 61 to 70 years of age (Student’s unpaired t test, P<0.05).

    Figure 6.

    Figure 6. Influence of diabetes on uptake of [3H]-choline and fractional release of [3H]-acetylcholine from human atrial segments. A, Uptake of radioactivity after incubation with [3H]-choline; B, S-I release of [3H]-acetylcholine in absence of drugs given as percentage of total tissue radioactivity present at time of stimulation (FR in %). Data are mean±SEM. *Significant difference between 10 diabetic patients with late complications and 8 diabetic patients without complications. +Significant difference between diabetic patients with late complications and 49 control patients without diabetes (Student’s unpaired t test, P<0.05).

    Table 1. Primer Settings for RT-PCR/PCR for Human Muscarinic Receptors

    ReceptorPrimerLocationProduct Length
    M1UP: 5′CAGAAGCCCCGTGGAAAGGAG 3′1121…1141401 bp
    LP: 5′CCGGGGACTGGGGTGGAG 3′1521…1504
    M2UP: 5′GTTACTGGCCTTTGGGACCTGT 3′360…381491 bp
    LP: 5′GCTGGGCATGTTGTTATTGTTTG 3′850…828
    M3UP: 5′ATCGGTCTGGCTTGGGTCATCTC 3′665…687367 bp
    LP: 5′AGCGGCCATACTTCCTCCTGTTG 3′1031…1009
    M4UP: 5′CCCCTGGGCGCCGTGGTCTG 3′395…414403 bp
    LP: 5′CCTCGGGCCGGTGCTTGTGGA 3′797…777
    M5UP: 5′CACTGCCATTGCTGCCTTCTACA 3′836…858422 bp
    LP: 5′ATTCTTCCCCTGGGCTTTCCTTAC 3′1257…1234

    Table 2. pKB Values of [3H]-Acetylcholine Release From Human Atria

    Muscarinic AntagonistpKB Value
    Atropine8.40±0.09
    Himbacine7.26 ±0.04
    AFDX-1166.37±0.04
    Tropicamide6.20±0.05
    Pirenzepine5.95±0.06

    Antagonist potencies of muscarinic antagonists (pKB values) against carbachol estimated according to Reference 14. Data are mean±SEM of 8 to 10 segments for each antagonist used.

    This study was supported by the Deutsche Forschungsgemeinschaft (Schw 784/1–2) and Zentrum Klinische Forschung 2, University Hospital Freiburg. We thank Petra Stunz for excellent technical assistance.

    Footnotes

    Correspondence to Lars Christian Rump, MD, Innere Medizin IV, Hugstetter Str 55, D-79106 Freiburg, Germany. E-mail

    References

    • 1 Levy MN. Neural control of cardiac function, Baillieres Clin Neurol..1997; 6:227–244.MedlineGoogle Scholar
    • 2 Azevedo ER, Parker JD. Parasympathetic control of cardiac sympathetic activity: normal ventricular function versus congestive heart failure. Circulation.1999; 100:274–279.CrossrefMedlineGoogle Scholar
    • 3 Makimattila S, Mantysaari M, Groop PH, et al. Hyperreactivity to nitrovasodilators in forearm vasculature is related to autonomic dysfunction in insulin-dependent diabetes mellitus. Circulation.1997; 95:618–625.CrossrefMedlineGoogle Scholar
    • 4 Poller U, Nedelka G, Radke J, et al. Age-dependent changes in cardiac muscarinic receptor function in healthy volunteers. J Am Coll Cardiol.1997; 29:187–193.CrossrefMedlineGoogle Scholar
    • 5 Kuo TB, Lin T, Yang CC, et al. Effect of aging on gender differences in neural control of heart rate. Am J Physiol.1999; 277:H2233–H2239.MedlineGoogle Scholar
    • 6 Lefrandt JD, Hoogenberg K, van Roon AM, et al. Baroreflex sensitivity is depressed in microalbuminuric Type I diabetic patients at rest and during sympathetic manoeuvres. Diabetologia.1999; 42:1345–1349.CrossrefMedlineGoogle Scholar
    • 7 Jeck D, Lindmar R, Loffelholz K, et al. Subtypes of muscarinic receptor on cholinergic nerves and atrial cells of chicken and guinea-pig hearts. Br J Pharmacol.1988; 93:357–366.CrossrefMedlineGoogle Scholar
    • 8 Bognar IT, Beinhauer B, Kann P, et al. Different muscarinic receptors mediate autoinhibition of acetylcholine release and vagally-induced vasoconstriction in the rat isolated perfused heart. Naunyn Schmiedebergs Arch Pharmacol.1990; 341:279–287.CrossrefMedlineGoogle Scholar
    • 9 Habermeier-Muth A, Altes U, Forsyth KM, et al. A presynaptic excitatory M1 muscarine receptor at postganglionic cardiac noradrenergic nerve fibres that is activated by endogenous acetylcholine. Naunyn Schmiedebergs Arch Pharmacol.1990; 342:483–489.MedlineGoogle Scholar
    • 10 Rump LC, Bohmann C, Schaible U, et al. Alpha 2C-adrenoceptor-modulated release of noradrenaline in human right atrium. Br J Pharmacol.1995; 116:2617–2624.CrossrefMedlineGoogle Scholar
    • 11 Brodde OE, Konschak U, Becker K, et al. Cardiac muscarinic receptors decrease with age: in vitro and in vivo studies. J Clin Invest..1998; 101:471–478.CrossrefMedlineGoogle Scholar
    • 12 Brodde OE, Michel MC. Adrenergic and muscarinic receptors in the human heart. Pharmacol Rev.1999; 51:651–690.MedlineGoogle Scholar
    • 13 Habermeier-Muth A, Muscholl E. Impulse interval-dependent effect of sympathetic nerve stimulation on evoked acetylcholine release from the rabbit perfused atria preparation. Naunyn Schmiedebergs Arch Pharmacol.1995; 351:156–163.MedlineGoogle Scholar
    • 14 Furchgott RF. The classification of adrenoceptors (adrenergic receptors): an evaluation from the standpoint of receptor theory. In: Blaschko H, Muscholl E, eds. Catecholamines: Handbook of Experimental Pharmacology. Berlin, Germany: Springer/Germany; 1972:283–335.Google Scholar
    • 15 Lazareno S, Birdsall NJ. Pharmacological characterization of acetylcholine-stimulated [35S]-GTP gamma S binding mediated by human muscarinic M1-M4 receptors: antagonist studies. Br J Pharmacol.1993; 109:1120–1127.CrossrefMedlineGoogle Scholar
    • 16 Watson N, Daniels DV, Ford AP, et al. Comparative pharmacology of recombinant human M3 and M5 muscarinic receptors expressed in CHO-K1 cells. Br J Pharmacol.1999; 127:590–596.CrossrefMedlineGoogle Scholar
    • 17 Dorje F, Wess J, Lambrecht G, et al. Antagonist binding profiles of five cloned human muscarinic receptor subtypes. J Pharmacol Exp Ther.1991; 56:727–733.Google Scholar
    • 18 Eglen RM, Choppin A, Dillon MP, et al. Muscarinic receptor ligands and their therapeutic potential. Curr Opin Chem Biol.1999; 3:426–432.CrossrefMedlineGoogle Scholar
    • 19 Molgaard H, Christensen PD, Hermansen K, et al. Early recognition of autonomic dysfunction in microalbuminuria: significance for cardiovascular mortality in diabetes mellitus? Diabetologia.1994; 37:788–796 .CrossrefMedlineGoogle Scholar
    • 20 Dawson JJ, Iannazzo L, Majewski H. Muscarinic autoinhibition of acetylcholine release in mouse atria is not transduced through cyclic AMP or protein kinase C. J Auton Pharmacol.1996; 16:79–85.CrossrefMedlineGoogle Scholar
    • 21 Nakatsuka H, Nagano O, Foldes FF, et al. Effects of adenosine on norepinephrine and acetylcholine release from guinea pig right atrium: role of A1-receptors. Neurochem Int.1995; 27:345–353.CrossrefMedlineGoogle Scholar
    • 22 Fabiani ME, Story DF. Effects of cromakalim, pinacidil and glibenclamide on cholinergic transmission in rat isolated atria. Pharmacol Res.1995; 32:155–163.CrossrefMedlineGoogle Scholar
    • 23 Deighton NM, Motomura S, Borquez D, et al. Muscarinic cholinoceptors in the human heart: demonstration, subclassification, and distribution. Naunyn Schmiedebergs Arch Pharmacol.1990; 341:414–421.MedlineGoogle Scholar
    • 24 Patel HJ, Barnes PJ, Takahashi T, et al. Evidence for prejunctional muscarinic autoreceptors in human and guinea pig trachea. Am J Respir Crit Care Med.1995; 152:872–878.CrossrefMedlineGoogle Scholar
    • 25 Barnes PJ. Muscarinic receptor subtypes: implications for therapy. Agents Actions Suppl.1993; 43:243–252.MedlineGoogle Scholar
    • 26 Somogyi GT, de Groat WC. Function, signal transduction mechanisms and plasticity of presynaptic muscarinic receptors in the urinary bladder. Life Sci.1999; 64:411–418.CrossrefMedlineGoogle Scholar
    • 27 D’Agostino G, Bolognesi ML, Lucchelli A, et al. Prejunctional muscarinic inhibitory control of acetylcholine release in the human isolated detrusor: involvement of the M4 receptor subtype. Br J Pharmacol.2000; 129:493–500.CrossrefMedlineGoogle Scholar
    • 28 Gadbut AP, Galper JB. A novel M3 muscarinic acetylcholine receptor is expressed in chick atrium and ventricle. J Biol Chem.1994; 269:25823–25829.MedlineGoogle Scholar
    • 29 Shi H, Wang H, Wang Z. Identification and characterization of multiple subtypes of muscarinic acetylcholine receptors and their physiological functions in canine hearts. Mol Pharmacol.1999; 55:497–507.MedlineGoogle Scholar
    • 30 Insel PA. Adrenergic receptors, G proteins, and cell regulation: implications for aging research. Exp Gerontol.1993; 28:341–348.CrossrefMedlineGoogle Scholar
    • 31 Esler M, Kaye D, Lambert G, et al. Adrenergic nervous system in heart failure. Am J Cardiol.1997; 80:7L-14L.CrossrefMedlineGoogle Scholar
    • 32 Blanco R, Saenz de Tejada I, Goldstein I, et al. Dysfunctional penile cholinergic nerves in diabetic impotent men. J Urol.1990; 144:278–280.CrossrefMedlineGoogle Scholar
    • 33 Kimura I, Okazaki M, Kimura M. Streptozocin-diabetes modifies acetylcholine release from mouse phrenic nerve terminal and presynaptic sensitivity to succinylcholine. Jpn J Pharmacol.1993; 62:35–41.CrossrefMedlineGoogle Scholar
    • 34 Welsh B, Wecker L. Effects of streptozotocin-induced diabetes on acetylcholine metabolism in rat brain. Neurochem Res.1991; 16:453–460.CrossrefMedlineGoogle Scholar
    • 35 Belmonte KE, Jacoby DB, Fryer AD. Increased function of inhibitory neuronal M2 muscarinic receptors in diabetic rat lungs. Br J Pharmacol.1997; 121:1287–1294. CrossrefMedlineGoogle Scholar
    Back to top