The bioactive steroid, marinobufagenin (MBG), is an endogenous Na/K-ATPase bufadienolide inhibitor that is synthesized by adrenocortical and placental cells. Elevated MBG levels participate in blood pressure increase via inhibiting of Na/K-ATPase in vasculature. Moreover, MBG binding to Na/K-ATPase initiates profibrotic cell signaling, and heightened MBG levels are implicated in the pathogenesis of hypertension, preeclampsia, heart failure, and chronic kidney disease. However, the mechanism of MBG biosynthesis in mammals remains unknown. Steroids are derived from cholesterol through the traditional steroidogenesis pathway initiated by enzyme CYP11A1, and via the acidic bile acid pathway, which is controlled by enzyme CYP27A1. Here, we show that in vitro, post-transcriptional silencing of the CYP27A1 gene in human trophoblast and rat adrenocortical cells significantly reduced the expression of CYP27A1 mRNA, reduced total bile acids and MBG levels >2-fold, when compared with nontreated cell. On the opposite, silencing of the CYP11A1 gene did not affect the MBG and total bile acids production in either cell lines. In vivo, in a dietary high-salt administration experiment, male and female Dahl-S rats became hypertensive after 4 weeks on a high-NaCl diet, their plasma MBG levels doubled, and adrenocortical CYP27A1 mRNA and protein increased 2.0-fold. Therefore, the endogenous Na/K-ATPase inhibitor, bufadienolide steroid MBG, is synthesized in mammalian placenta and adrenal cortex from cholesterol through the novel acidic bile acid pathway. These findings will help to understand the role of MBG and its turnover in highly prevalent human cardiovascular diseases, which includes hypertension, chronic renal failure, heart failure, and preeclampsia.
Synthesis of an Endogenous Steroidal Na Pump Inhibitor Marinobufagenin, Implicated in Human Cardiovascular Diseases, Is Initiated by CYP27A1 via Bile Acid Pathway
Circulation: Cardiovascular Genetics
Abstract
Background—
The bioactive steroid, marinobufagenin, is an endogenous Na/K-ATPase bufadienolide inhibitor that is synthesized by adrenocortical and placental cells. Marinobufagenin binding to Na/K-ATPase initiates profibrotic cell signaling, and heightened marinobufagenin levels are implicated in the pathogenesis of hypertension, preeclampsia, and chronic kidney disease. Steroids are derived from cholesterol through the traditional steroidogenesis pathway initiated by enzyme CYP11A1, and via the acidic bile acid pathway, which is controlled by enzyme CYP27A1. The mechanism of marinobufagenin biosynthesis in mammals, however, remains unknown.
Methods and Results—
Here, we show that post-transcriptional silencing of the CYP27A1 gene in human trophoblast and rat adrenocortical cells reduced the expression of CYP27A1 mRNA by 70%, reduced total bile acids 2-fold, and marinobufagenin levels by 67% when compared with nontreated cells or cells transfected with nontargeting siRNA. In contrast, silencing of the CYP11A1 gene did not affect marinobufagenin production in either cell culture, but suppressed production of progesterone 2-fold in human trophoblast cells and of corticosterone by 90% in rat adrenocortical cells when compared with cells transfected with nontargeting siRNA. In vivo, in a high-salt administration experiment, male and female Dahl salt-sensitive rats became hypertensive after 4 weeks on a high-NaCl diet, their plasma marinobufagenin levels doubled, and adrenocortical CYP27A1 mRNA and protein increased 1.6-fold and 2.0-fold.
Conclusions—
Therefore, the endogenous steroidal Na/K-ATPase inhibitor, marinobufagenin, is synthesized in mammalian placenta and adrenal cortex from cholesterol through the novel acidic bile acid pathway. These findings will help to understand the role of marinobufagenin in highly prevalent human cardiovascular diseases.
Introduction
The bioactive steroid, marinobufagenin (Figure 1A), is an endogenous bufadienolide Na/K-ATPase ligand and inhibitor.1–5 Recent studies demonstrate that increased levels of endogenous Na/K-ATPase ligands including marinobufagenin are implicated in the pathogenesis of chronic kidney disease, essential hypertension, and preeclampsia.1–10 Thus, hypertensive Dahl salt-sensitive rats (Dahl-S) have an increased plasma and adrenocortical levels of marinobufagenin, which was accompanied by inhibition of Na/K-ATPase and blood pressure elevation.1,11 Angiotensin II stimulates marinobufagenin production in adrenal cortex of Dahl-S rats in vitro and in vivo.12 Previously it was demonstrated that adrenalectomy in rats resulted in the reduction of plasma digoxin-like immunoreactivity13 and marinobufagenin levels,14 which indicated that adrenals are the major source of marinobufagenin and other cardiotonic steroids in mammals.
Clinical Perspective on p 745
Increasing evidence indicates that, in addition to inhibition of Na/K-ATPase, marinobufagenin is capable to initiates potent cell signaling via binding to Na/K-ATPase.5,15 Marinobufagenin via modulation of Na/K-ATPase activity not only participates in blood pressure regulation but also induces cardiac and vascular fibrosis,10 a hallmark of cardiovascular aging, resistant hypertension, and chronic kidney disease.16,17 Thus, administration of an antimarinobufagenin monoclonal antibody in salt-sensitive hypertension models lowers blood pressure,9 reverses preeclampsia-induced Na/K-ATPase inhibition,9 and potently reverses cardiac fibrosis in uremic rats,2,6 states where the marinobufagenin levels are increased.
Despite the fact that bufadienolide sodium pump ligands are emerging as potentially important therapeutic targets, mechanisms of their biosynthesis are not understood, and the paucity of knowledge on the biosynthesis of the steroidal Na/K-ATPase inhibitor, marinobufagenin, has hampered the research on therapeutic targeting of marinobufagenin-driven Na/K-ATPase regulatory signaling. Steroids are derived from cholesterol, and the traditional biosynthesis of biologically active steroids begins via the side-chain cleavage of cholesterol by the cytochrome P450 enzyme CYP11A1 and conversion into pregnenolone18,19 (Figure 2) although this pathway is not involved in marinobufagenin biosynthesis.20
The biosynthesis pathways, other than traditional steroidogenesis, which also generate physiologically active steroids, include classical and acidic bile acid pathways21–23 (Figure 2), in which cholesterol is cleaved, respectively, by CYP7A1, an enzyme, expressed only in the liver,24 and by CYP27A1, an enzyme, expressed in the extrahepatic tissues, including adrenal glands.22,25–27 Because marinobufagenin is synthesized in nonhepatic tissues,1,4,12 and CYP7A1 is expressed only in the liver,24 we hypothesized that mammalian marinobufagenin is a bioactive bile acid derivative steroid, synthesized via the acidic extrahepatic pathway that oxidizes cholesterol into bile acids by CYP27A1 enzyme. To test this hypothesis, we studied (1) the levels of marinobufagenin, produced by human choriocarcinoma JEG-3 cells; (2) the role of post-transcriptional CYP27A1 gene silencing on marinobufagenin production in human trophoblast and primary culture of rat adrenocortical cells; (3) the possible participation of adrenocortical CYP27A1 in marinobufagenin production in the model of salt-sensitive hypertension in Dahl-S rats.
Materials and Methods
High-Sodium Chloride Diet in Dahl Salt-Sensitive Model (Animal Study)
Dahl-S rats (5 weeks old, both sexes; Charles River, Frederick, MD) were used for dietary high-NaCl administration. This experiment was approved by Institutional Animal Care and Use Committee. The rats were maintained in a 26°C environment with a 12:12-hour light-dark cycle on a low-salt diet (0.3% NaCl; Harlan Teklad, Madison, WI) and tap water ab libitum for an adaptation for 1 week. Six animals of each sex were then placed on a high-NaCl diet (8% NaCl; Harlan Teklad). Control animals (males, n=6; and females, n=6) were maintained on a low-salt diet for 4 weeks. Blood pressure was measured in conscious animals by tail-cuff plethysmography (IITC Life Science, Woodland Hills, CA) at baseline and after 4 weeks of a high-NaCl diet. The adrenal glands were collected for the measurement of CYP11A1, CYP27A1, CYP11B1, and CYP11B2 mRNA expression in adrenal cortex (real-time quantitative polymerase chain reaction [qPCR]; below), for Western blotting and histochemistry analyses (below). Plasma was extracted using Sep-Pak C-18 reverse-phase cartridges (Waters, Milford, MA), as reported previously,9 and used for measurement of marinobufagenin (immunoassay; below).
Human Placental and Rat Adrenocortical Cell Cultures
The human choriocarcinoma cell line JEG-3 was obtained from ATCC (American Type Culture Collection, Manassas, VA) and maintained in Eagle’s Minimum Essential Medium (ATCC) in the presence of 10% fetal bovine serum (FBS; Life Technologies/Invitrogen, Grand Island, NY) and antibiotics, penicillin 100 U/mL and streptomycin 100 μg/mL (Life Technologies/Invitrogen). Cells from passages 2 to 5 were used in the experiments.
A rat adrenocortical primary cell culture was prepared as described previously.12 Twelve 3- to 4-month-old Dahl salt-sensitive rats (Charles River Laboratories International, Inc, Wilmington, MA) were euthanized by an overdose of sodium pentobarbital (100 mg/kg), adrenals were removed, washed in 0.9% NaCl, the cortex was isolated, minced, and incubated for 1 hour at 37°C placed in Dulbecco’s modified essential medium/F-12 medium (DMEM/F-12; Life Technologies/GIBCO, Grand Island, NY) containing 0.5% FBS (Life Technologies/Invitrogen), 1 mg/mL collagenase type IV (Worthington Biochemical Corp, Lakewood, NJ), 1 μg/mL deoxyribonuclease (DNAse-I from bovine pancreas; Sigma-Aldrich, St. Louis, MO), and antibiotics penicillin and streptomycin (Life Technologies/Invitrogen). The tissue was ground through a 53-μm Spectra Mesh Woven Nylon filter (Spectrum Laboratories, Inc, Ranch Dominguez, CA), cells were collected, centrifuged at 200g for 5 minutes, and cultured in DMEM/F-12 media with 10% FBS. Media was replaced every 2 to 3 days. Cell from passages 2 to 4 were used for the further analyses.
Concentrations of marinobufagenin, bile acids, progesterone or corticosterone produced by JEG-2 and adrenocortical cells were estimated by immunoassays of the extracted media. When the JEG-3 cells reached the 80% to 90% confluence, the 10% FBS media was replaced by 2.5% FBS media. JEG-3 cells were incubated for 0, 3, or 6 hours. The media were collected for marinobufagenin measurements and for purification of marinobufagenin-immunoreactive material via HPLC (below). Cells were washed with 100-μL 0.05% trypsin in 0.53 mmol/L EDTA and centrifuged at 3000g for 5 minutes; the final pellet of cells was dissolved in 50 μL of RIPA lysis buffer with protease/phosphatase inhibitors (radioimmunoprecipitation assay lysis buffer; Santa Cruz Biotechnology, Inc, Santa Cruz, CA) and used for protein measurement and Western blot analysis (below).
CYP27A1 and CYP11A1 Genes Silencing
Double-stranded siRNAs were used to silence CYP27A1 and CYP11A1 genes. Oligonucleotides for gene silencing in human cells were obtained from Qiagen, Valencia, CA (4 siRNAs for CYP27A1, catalog numbers SI00015533, SI00015540, SI00015547, and SI00015554), and Thermo Scientific/Dharmacon (Pittsburg, PA; siRNA for CYP11A1 ON-TARGETplus SMARTpool L-008329-00-0005). Oligonucleotides for gene silencing in rat cells were obtained from Dharmacon (CYP27A1rat ON-TARGETplus SMARTpool, and CYP11A1rat ON-TARGETplus SMARTpool). ON-TARGETplus Non-targeting pool with no homology to mammalian genes (Thermo Scientific/Dharmacon; catalog number D-001810-10-20) was used as a negative control for both JEG-3 and adrenocortical cells.
Before silencing, experiments JEG-3 and adrenocortical cells were cultured in 6-well plates 24 to 48 hours at a density 2×10E5 cells per well in correspondent media with 10% FBS. When cells reached the 60% to 65% confluence, the transfection was performed with 100 nmol/L siRNA in the presence of 5 μL/mL of transfection reagent Gene Silencer (Genlantis, San Diego, CA) in 1 mL/well of culture media without FBS; 6 hours later an equal volume of correspondent media with FBS was added to the final concentration 10% FBS.
Effects of gene silencing were assessed by real-time qPCR and Western blot analyses. For qPCR, cells were cultured for 24 hours after silencing, and for western blot, cells were cultured for an additional 48 hours. Media for marinobufagenin and other steroid measurements were collected 72 hours after silencing, during which the 10% FBS media were replaced by 2.5% FBS correspondent media, cells were incubated for 6 hours, and culture media and cells were collected as above (cell culture).
Real-Time Quantitative PCR
Real-time quantitative analysis of CYP11A1, CYP11B1, CYP11B2, and CYP27A1 mRNA levels was performed by PCR amplification of the resulting cDNAs and normalized to expression of housekeeping genes as the internal standards (rat and human 18S ribosomal mRNA for rat adrenocortical cells and tissue and for human JEG-3 cells). In detail, total RNA was extracted from JEG-3 cells and from adrenocortical cells or adrenocortical tissue, which were collected 24 hours after the transfection (Qiagen RNeasy mini-kit in the presence of DNase-I; Qiagen). Total RNA samples were then reverse transcribed to cDNA using TaqMan Reverse transcription kit (Life Technologies/Applied Biosystems, Grand Island, NY). Primer sets for real-time PCR for rat CYP11A1, CYP11B1, CYP11B2, and both rat and human CYP27A1 genes, and housekeeping rat and human 18S ribosomal RNA genes were obtained from Qiagen (Table 1). Primers for human CYP11A1 were designed using Primer-BLAST tool designed by NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast/primerinfo.html): Primer-BLAST is based on Primer 3 software, and specificity of primers is confirmed using NCBI Blast database. Quantitative real-time PCR was performed using QuantiFast SYBR Green PCR kit (Qiagen) according to the manufacture’s protocol, and ABI 7300 Real Time PCR System (Life Technologies/Applied Biosystems). For each sample, gene expression was analyzed using the following protocol: activation at 95°C (8 minutes) followed by 40 cycles, consisting of a first phase of denaturation at 95°C (10 s), and a second phase of annealing/extending at 60°C (30 s). Each reaction was performed in triplicate with an inclusion of no-template controls in each experiment. A dissociation curve analysis was performed in each experiment to eliminate nonspecific amplification, including primer dimers. The 18S Ct values were subtracted from the raw sample Ct values to obtain the corrected Ct. Power conversion (power (2−(correctedCt)) was used to convert corrected Ct to relative RNA quantity.
| Gene | Primer |
|---|---|
| CYP11A1 human | Forward: AGCTCGGCAACGTGGAGTCGReverse: ACCCAGGGCGGGATGAGGAA |
| CYP27A1 human | Hs_CYP27A1_1_SG QuantiTect Primer Assay (Qiagen) |
| 18S ribosomal RNA gene human | Hs_RRN18S_1_SG QuantiTect Primer Assay (Qiagen) |
| CYP11A1 rat | Rn_CYP11a1_1_SG QuantiTect Primer Assay (Qiagen) |
| CYP27A1 rat | Rn_CYP27a1_1_SG QuantiTect Primer Assay (Qiagen) |
| CYP11B1 rat | Rn_CYP11B1_2_SG QuantiTect Primer Assay (Qiagen) |
| CYP11B2 rat | Rn_CYP11B2_1_SG QuantiTect Primer Assay (Qiagen) |
| 18S ribosomal RNA gene rat | Rn_RNR1_1_SG QuantiTect Primer Assay (Qiagen) |
Immunoassays
Seventy-two–hours after transfection with siRNA, both cell cultures were used to study the effect of CYP27A1 and CYP11A1 silencing on production of marinobufagenin, total bile acids and progesterone (JEG-3 cells), and corticosterone (adrenocortical cells). Culture media samples were collected as described above (marinobufagenin production) and extracted using Sep-Pak C-18 reverse-phase cartridges (Waters), as reported previously.9 Marinobufagenin concentration was measured using a DELFIA immunoassay kit based on 4G4 monoclonal antimarinobufagenin antibody.9 Cross-immunoreactivity of this antibody is (%): marinobufagenin, 100; marinobufotoxin, 43; cinobufotalin, 40; telocinobufagin, 14; resibufagenin, 0.5; bufalin, 0.08; cinobufagin, 0.07; digoxin, 0.03; ouabain, 0.005; ouabagenin, 0.001; digoxigenin, 0.004; proscillaridin A, digitoxin, aldosterone, progesterone, prednisone, corticosterone, and thyroglobulin, <0.001.
The concentration of progesterone and total bile acid in the cell culture media was measured after C18 extraction using a Progesterone DELFIA immunoassay kit (Perkin Elmer, Waltham, MA) and total bile acid colorimetric enzymatic assay kit (Bio-Quant, Inc, San Diego, CA). Adrenocortical cell corticosterone production was measured in the media by an ELISA (Cayman Chemical Company, Ann Arbor, MI). The total amount of steroids per sample was normalized to the total amount of cell protein per sample.
HPLC
For the time course of marinobufagenin production, 6 mL of media conditioned by JEG-3 cells for 0 (baseline), 3, or 6 hours were extracted by 80% acetonitrile using Sep-Pak C-18 reverse-phase cartridges (Waters),9 and the resultant extract was fractionated on an Agilent 1100 series HPLC system using Agilent Zorbax Eclipse XDB-C18 (Agilent Technologies, Palo Alto, CA), 4.6×150 mm, 5-μm particle size, 80 Å column, flow rate 1 mL/min, in linear (10%–85.5%) gradient of acetonitrile against 0.1% trifluoroacetic acid for 45 minutes.9 Thirty 1.5-minute fractions were collected and analyzed for marinobufagenin-immunoreactivity (marinobufagenin immunoassay, above).
Western Blotting
Cell or adrenocortical tissue lysates in RIPA buffer (Santa Cruz Biotechnology) were pretreated in sample buffer (Life Technologies/Invitrogen) for 5 minutes at 90°C, and 30- to 40-μg protein per lane was loaded on 10% SDS-PAGE gel (Life Technologies/Invitrogen). After electrophoresis, proteins were transferred to nitrocellulose membranes (Life Technologies/Invitrogen). Membranes were blocked for 1 hour with 5% nonfat dry milk in PBS with 0.1% Tween-20 and subsequently incubated with a 1:250 rabbit polyclonal CYP27A1 antibody (Abcam, Cambridge, MA) or with a 1:500 rabbit polyclonal CYP11A1 antibody (Abcam), followed by the incubation with an antirabbit-HRP antibody (1:1000; Fisher Scientific, Pittsburgh, PA) for JEG-3 cells. For rat adrenocortical cells and adrenocortical tissue, proteins were detected with CYP11A1 and CYP27A1 goat polyclonal antibodies followed by the secondary antigoat-HRP antibodies (Santa-Cruz Biotechnology). The gel loading control was performed by anti-GAPDH mouse antibody (Santa-Cruz Biotechnology). Protein bands were visualized with Pierce SuperSignal West Pico Chemiluminescent Substrate or with ECL Western Blotting System (Fisher Scientific), and protein amounts were measured by densitometric analysis, using Kodak molecular imaging software, version 5.0 (Molecular Imaging Systems; Carestream Health, Inc, Rochester, NY).
Immunohistochemistry
Immunohistochemical staining was performed on formalin fixed, paraffin embedded 6-μm adrenal tissue sections, mounted on Superfrost/plus slides (Fischer Scientific, Pittsburgh, PA), deparaffinized in xylene, and rehydrated through a graded series of ethanol. Sections were heated to 90°C in antigen unmasking citrate buffer (Thermo Scientific, Freemont, CA) and slowly cooled down to room temperature. Endogenous peroxidase was quenched by incubation in 3% hydrogen peroxide in PBS (Fischer Scientific) for 10 minutes. After 10 minutes of blocking (10% nonimmune serum and 1% BSA in PBS), the slides were incubated overnight at 4°C in humidified chamber with rabbit anti-CYP27A1 antibody (Abcam; 1:100 in 1% BSA in PBS). Next the slides were incubated with biotinylated secondary antibody followed by horseradish peroxidase conjugated streptavidin (LAB-SA detection system; Invitrogen, Camarillo, CA). The immunoreactivity was visualized with 0.05% 3,3′-diaminobenzidine, followed by 5-minute counterstaining with hematoxylin to visualize nuclei (American Mastertech Scientific, Lodi, CA). The specificity of the immunostaining was evaluated by omission of the primary antibody and processed as above. A brown reaction product indicated localization of CYP27A1.
Color images were captured with the ZEISS Axioplan microscope (Thornwood, NY) using a QCAM FAST 1394 digital camera (QImaging, Surrey, Canada). Quantitative analysis of CYP27A1 content was performed with MetaMorph Image Analysis Software (Molecular Devices Corporation, Sunnyvale, CA), and was calculated as the ratio of area stained with CYP27A1:total adrenal cortex area. Total 4 to 5 slides of adrenocortical tissue from each of 6 rats per group were analyzed.
Statistics
The results are presented as mean±SEM (or mean± SD, as specified in the table and figure legends. Shapiro–Wilks normality tests (GraphPad Prism Software, San Diego, CA) were conducted for each sample and for each variable. Practically all of the samples passed the normality test (a=0.05). Next, the Bartlett test for equal varian ces detected that the variances did not differ significantly among the groups. Because our data were consistent with normal distributions with constant variance, the parametric ANOVA was applied for data analyses: 1-way ANOVA followed by Bonferroni or Newman–Keuls tests (intragroup analysis) or repeated measures ANOVA followed by Newman–Keuls test (intergroup analysis) as specified in the table and figure legends (GraphPad Prism Software). A 2-sided P value of <0.05 was considered to be statistically significant.
Results
Because substantial quantities of bufadienolides are synthesized in the placenta,4 we first studied marinobufagenin production by human trophoblast JEG-3 cells. Figure 1B shows that the level of marinobufagenin-immunoreactivity, detected by a 4G4 antimarinobufagenin monoclonal antibody in the conditioned media of JEG-3 cells, increased exponentially during 6 hours of observation. Figure 1C and 1D shows that after HPLC-fractionation of C18-extracted media conditioned by JEG-3 cells, the maximum of marinobufagenin-immunoreactivity coeluted with marinobufagenin standard in a single peak at 24 minutes (fraction 16).
Figure 3 summarizes the results of experiments in which CYP27A1 and CYP11A1 genes in JEG-3 cells were silenced. After transfection of a CYP27A1-specific small interfering RNA (RNAi), expression of CYP27A1 mRNA was reduced by 76% (Figure 3A). Silencing of CYP27A1 gene reduced the level of CYP27A1 protein by 70% (Figure 3B), induced more than a 2-fold reduction in bile acid levels (Figure 3G), and led to a 67% reduction in the marinobufagenin level in the conditioned medium (Figure 3E), but did not affect the level of progesterone (Figure 3F). In contrast, silencing of CYP11A1 gene (Figure 3C and 3D) reduced the expression of CYP11A1 mRNA by 80%, and levels of CYP11A1 protein by 75%, but did not affect the levels of bile acids or marinobufagenin in the conditioned medium (Figure 3E and 3G), and markedly reduced the level of progesterone (Figure 3F), a product of cholesterol side-chain cleavage (Figure 2). Transfection with nontargeting siRNA did not affect production of any steroids.
Because the adrenal cortex is a major site for steroidogenesis in mammals,12 it was important to establish whether CYP27A1 is also implicated in biosynthesis of marinobufagenin in adrenocortical cells. CYP11A1 and CYP27A1 genes were silenced in a primary culture of adrenocortical cells from Dahl salt-sensitive rats, ie, cells known to produce substantial amounts of marinobufagenin.12 Figure 4 shows that transfection of adrenocortical cells with a CYP27A1-specific small interfering RNA reduced the expression of CYP27A1 mRNA by 76%, reduced the level of CYP27A1 protein by 73%, and also reduced marinobufagenin production by 70%, but not that of corticosterone (Figure 4C–4F), a product of cholesterol side-chain cleavage. Conversely, silencing of CYP11A1 gene in adrenocortical cells reduced the expression of CYP11A1 mRNA by 84%, level of CYP11A1 protein by 78%, and resulted in 10-fold reduction in the level of corticosterone (Figure 4A–4C), but did not affect the levels of marinobufagenin in the conditioned medium (Figure 4F).
The effect of a high-salt diet in Dahl-S rats on blood pressure, plasma marinobufagenin levels, and adrenocortical CYP27A1 and CYP11A1 protein and mRNA is presented in Figures 5–7. After 4 weeks of a high-salt diet, male Dahl-S rats demonstrated elevated systolic blood pressure (Figure 5A), increased plasma marinobufagenin levels (1.75-fold; Figure 5B), increased adrenocortical CYP27A1 mRNA and CYP27A1 protein, estimated by Western blotting (Figure 5C and 5D) and by immunohistochemistry (Figure 6), but adrenocortical CYP11A1 protein and mRNA levels did not change (Figure 7A and 7B) versus the low-salt–fed group. Female Dahl-S rats on a high-salt diet also demonstrated elevated systolic blood pressure (Figure 5A), increased plasma marinobufagenin levels (1.83-fold, Figure 5B), increased adrenocortical CYP27A1 protein level (Figure 5C, Western blotting; Figure 6, immunohistochemistry) and CYP27A1 mRNA (Figure 5D), but adrenocortical CYP11A1 protein and mRNA levels did not change (Figure 7A and 7B). Notably, that systolic blood pressure, plasma marinobufagenin levels, and adrenocortical CYP27A1 protein abundance and CYP27A1 mRNA expression were significantly lower in females than in males on both low- and high-salt diets (Figure 5). In contrast, adrenocortical CYP11A1 mRNA expression and CYP11A1 protein levels were higher in Dahl-S females than in Dahl-S males on both diets (Figure 7A and 7B).
Data on the effect of a high-NaCl diet for 4 weeks versus low-salt diet on CYP27A1 abundance, detected by immunostaining in adrenocortical tissue from Dahl-S male and female rats, are presented in Figure 6. The representative immunohistochemical images of adrenocortical tissue from each Dahl-S experimental groups are shown in Figure 6A–6D. CYP27A1 is stained brown by anti-CYP27A1 antibody. The intensity of CYP27A1 staining was more pronounced in adrenocortical zona fasciculata than in other adrenocortical zones, and it was greater in both males and females high-salt–fed diet for 4 weeks than in those low-salt–fed control groups (Figure 6E). No significant sex difference in CYP27A1 abundance was detected by immunohistochemistry technique (Figure 6).
Previously it was demonstrated that CYP11B1 is predominantly expressed in zona fasciculata of adrenal cortex, and CYP11B2 in zona glomeruloza28; therefore, the ratio of adrenocortical CYP11B1 and CYP11B2 mRNA expression may be used as a marker of a relative contribution of tissue material from these adrenocortical zones to the production of the steroid of interest. Expression of adrenocortical CYP11B1 mRNA was significantly higher than that of CYP11B2 mRNA in both sexes on both diets (Figure 7C and 7D). The expression ratio of CYP11B1 mRNA:CYP11B2 mRNA in males and females on a low- and high-NaCl diets is given in Table 2. Adrenocortical CYP11B1 mRNA did not change after 4 weeks of a high-salt diet in both males and females (Figure 7C), and CYP11B2 mRNA dramatically decreased in both males and females on a high-salt diet versus low-salt intake (Figure 7D). Because the ratio of CYP11B1/CYP11B2 mRNA expression in adrenocortical samples is >150 (Table 2) and because CYP11B1 is predominantly expressed in zona fasciculata of adrenal cortex,28 we conclude that the adrenocortical material in our experiment, used for CYP27A1 mRNA and protein measurements, was represented by the zona fasciculata.
| Males (n=12) | Females (n=12) | |
|---|---|---|
| CYP11B1/CYP11B2 ratio (low-salt diet) | 182±60 | 366±226* |
| CYP11B1/CYP11B2 ratio (high-salt diet) | 8888±4023† | 9538±2648† |
Values are mean±SD.
*
P<0.01, males vs females at low-salt diet.
†
P<0.01, high-salt diet vs low-salt diet by 1-way ANOVA followed by Newman–Keuls test, which was used to compare 4 groups defined by 2 factors.
Discussion
Our results demonstrate, for the first time, that the mammalian steroid marinobufagenin, an endogenous sodium pump ligand of bufadienolide nature, is derived from bile acids, and its biosynthesis is initiated by CYP27A1 enzyme. This observation was made in rat adrenocortical and human placental cells, which were chosen as models for bile acid pathway studies because these tissues are known to produce marinobufagenin. Thus, we cannot exclude that marinobufagenin can be produced in other mammalian tissues and organs. Bile acid synthesis originally was thought to be limited to the liver.24 Later, the extrahepatic synthesis of bile acids via an acidic pathway was described, and bile acids were identified not only as a product of cholesterol elimination but also as regulatory signaling molecules implicated in genesis of several diseases including diabetes mellitus and cancer.21,22,29 Growing evidence indicates the physiological importance of regulatory enzyme CYP27A1 for acidic bile acid pathway, which participates in oxysterol formation, cholesterol transport, and homeostasis and activates metabolic signaling pathways.21,22,30,31 Activation of CYP27A1 is an adaptive mechanism for cholesterol utilization in human adipocytes followed by the de novo biosynthesis of steroids.25 CYP27A1 also increased the expression of markers of EMT and fibrosis in mouse breast cancer cells.26 The results of the present study indicated that the production of marinobufagenin, which participates in initiation of the profibrotic pathways in different tissues in clinical settings and experimental models,2,3,10 is also controlled by CYP27A1 in both rat and human tissues.
Excessive production of marinobufagenin causes inhibition of vascular Na/K-ATPase and accompanies elevated blood pressure in essential hypertension,1 chronic kidney disease,2,6 and preeclampsia,3 a major cause of maternal and fetal morbidity worldwide.8 An increasing body of evidence indicates that in addition to its traditional transport function, Na/K-ATPase is a potent generator of cell signaling.5,15 In addition to increasing vascular tone, marinobufagenin induces cardiac and vascular fibrosis,10 which is a hallmark of cardiovascular aging, resistant hypertension, chronic kidney disease, and preeclampsia.16,17,32 In preeclampsia, heightened marinobufagenin levels contributed to blood pressure increase3,9,32 and development of vascular remodeling.3 Notably, that infusion of marinobufagenin to rats produced effects similar to cardiovascular diseases in animal models of salt-sensitive hypertension and chronic renal failure.6,10,14 In our previous study, the infused marinobufagenin increased blood pressure, changed ventricular hemodynamics, and increased cardiac and aortic deposition of collagen-1 in parallel with cardiovascular remodeling.14 Physiologically relevant concentrations of marinobufagenin stimulate synthesis of collagen-1 in vitro and induce cardiac fibrosis in rats with renal failure,10 and an antimarinobufagenin monoclonal antibody potently reverses cardiac fibrosis.2,6
In the present study, we have shown that mammalian marinobufagenin production is controlled by CYP27A1 enzyme, but not by CYP11A1. Silencing of CYP27A1 mRNA in adrenocortical cell cultures reduced total bile acids and marinobufagenin levels, indicating the participation of the acidic bile acid pathway in marinobufagenin production. In contrast, silencing of CYP11A1 mRNA did not affect marinobufagenin, but caused a decrease in progesterone (JEG-3 cells) and in corticosterone (rat adrenocortical cells), which require side-chain cleavage of cholesterol. This is in agreement with the previous observation that the traditional steroidogenesis via the side-chain cleavage of cholesterol is not involved in the biosynthesis of marinobufagenin.20 In this study, the de novo biosynthesis of marinobufagenin in murine Y1 adrenocortical cells required cholesterol as a precursor, but did not involve the conversion of cholesterol to pregnenolone via side-chain cleavage by CYP11A1.20
A discovery made >40 years age in Bufo marinus toads,33,34 which produce large quantities of bufadienolides, including marinobufagenin, for protection against predators, indicated that amphibian bufadienolides are synthesized from bile acids.33,34 Those authors demonstrated that in toads, the in vivo administration of radioactive label from cholesterol-14C and sodium 3β-hydroxy-5β-cholanate-24-14C, but not from radiolabeled pregnenolone, was incorporated into bufadienolide, including marinobufagenin.31 Notably, a product of acidic pathway of bile acid biosynthesis in humans is also identified as 3β-hydroxy-5-cholestenoic acid.35 Interestingly, some researches include 3β-hydroxy-5β-cholanate in the acidic bile acid pathway.25,30,36,37 It was previously demonstrated that a major biological function of CYP27A1 in human tissues is conversion of cholesterol into 27-hydroxycholesterol and 3β-hydroxy-5-cholestenoic acid,38 which regulate the expression of nuclear receptors and modulate cholesterol metabolism.35 Remarkably, 3β-hydroxy-5β-cholanate was found in amniotic fluid of human fetuses, human newborn urine,39,40 and in plasma of pregnant women,41 which is consistent with our observation of elevated plasma marinobufagenin levels in pregnancy.3,9,32 The present findings, that human choriocarcinoma cells produced marinobufagenin (Figure 1) and that marinobufagenin production is affected by silencing of CYP27A1 (Figure 3A, 3B, and 3E), are in agreement with the previous data.
27-hydroxycholesterol (Figure 2) is an endogenous selective estrogen receptor modulator and adversely affects estrogen-related cardiovascular protection.42 The upregulation of CYP27A1, which is important for the production of 27-hydroxycholesterol, may have a dramatic impact on the cardiovascular system, bone biology, and cancer.42,43 Circulating levels of 27-hydroxycholesterol increase with age and are lower in females than in males,42 indicating that CYP27A1 activity and CYP27A1 gene expression may be lower in females,44 which is consistent with our present observation that mRNA CYP27A1 level in adrenocortical tissue from female rats is 2.5-fold lower than from males. Notably, in the present study, CYP11A1 protein abundance, CYP11A1 mRNA, and CYP11B1 mRNA are higher in female than in male Dahl-S rats, which is also in agreement with the previous finding.44 This indicates that in females, higher expression of genes involved in sex steroid and mineralocorticoid hormone synthesis is accompanied by lower expression of genes regulating basal cell function, which may include production of natriuretic steroid marinobufagenin. Interestingly, circulating levels of marinobufagenin in female rats were also 2-fold lower than in males and were associated with lower systolic blood pressure in females at baseline than in males. It is tempting to speculate that a lower circulating marinobufagenin level in females is an adaptive mechanism because, during pregnancy, additional marinobufagenin will be synthesized in placenta, as demonstrated in our previous4 and in the present studies.
Expression of CYP27A1 mRNA in adrenocortical tissue in both males and females increased 1.6-fold after 4 weeks on a high-NaCl diet and was associated with increase in plasma marinobufagenin and elevation of blood pressure in both sexes. The observation that a high-salt diet–induced upregulation of adrenocortical CYP27A1 mRNA and increase in CYP27A1 protein abundance was accompanied by an increase in circulating marinobufagenin, as well as the finding that in vitro silencing of CYP27A1 mRNA in rat adrenocortical cell culture was accompanied by a decrease in produced marinobufagenin levels, provides a strong evidence for a relationship between CYP27A1 activation and production of the steroid marinobufagenin. Previous observations that bilateral adrenalectomy resulted in partial reduction of plasma marinobufagenin levels14 indicated that adrenocortical tissue is the predominant, but not the sole, source of marinobufagenin in mammals. In the present and our previous study,4 we demonstrated that marinobufagenin is also produced by placental cells.
Thus, the present results demonstrate that mammalian bufadienolide steroid marinobufagenin, an endogenous ligand of the Na/K-ATPase and a prohypertensive factor, is likely to be synthesized via an extrahepatic acidic bile acid pathway similar to amphibian marinobufagenin.34 Specific chemical reactions in the transformation of bile acids into bufadienolide molecules have been described in amphibians35; however, these reactions remain unknown in mammals and merit further investigation. Our present finding that biosynthesis of prohypertensive and profibrotic steroid marinobufagenin is controlled by CYP27A1 gives a new direction for future studies, which will likely enable the emergence of novel therapeutic strategies to block marinobufagenin production to reduce its impact on highly prevalent human diseases involving heightened levels of marinobufagenin.
Acknowledgments
We are grateful to Dr. Christopher H. Morrell for statistical analyses and Ruth Sadler for editorial assistance.
CLINICAL PERSPECTIVE
References
1.
Fedorova OV, Talan MI, Agalakova NI, Lakatta EG, Bagrov AY. Endogenous ligand of alpha(1) sodium pump, marinobufagenin, is a novel mediator of sodium chloride–dependent hypertension. Circulation. 2002;105:1122–1127. doi: 10.1161/hc0902.104710.
2.
Kolmakova EV, Haller ST, Kennedy DJ, Isachkina AN, Budny GV, Frolova EV, et al. Endogenous cardiotonic steroids in chronic renal failure. Nephrol Dial Transplant. 2011;26:2912–2919. doi: 10.1093/ndt/gfq772.
3.
Nikitina ER, Mikhailov AV, Nikandrova ES, Frolova EV, Fadeev AV, Shman VV, et al. In preeclampsia endogenous cardiotonic steroids induce vascular fibrosis and impair relaxation of umbilical arteries. J Hypertens. 2011;29:769–776. doi: 10.1097/HJH.0b013e32834436a7.
4.
Fedorova OV, Tapilskaya NI, Bzhelyansky AM, Frolova EV, Nikitina ER, Reznik VA, et al. Interaction of Digibind with endogenous cardiotonic steroids from preeclamptic placentae. J Hypertens. 2010;28:361–366. doi: 10.1097/HJH.0b013e328333226c.
5.
Bagrov AY, Shapiro JI, Fedorova OV. Endogenous cardiotonic steroids: physiology, pharmacology, and novel therapeutic targets. Pharmacol Rev. 2009;61:9–38. doi: 10.1124/pr.108.000711.
6.
Haller ST, Kennedy DJ, Shidyak A, Budny GV, Malhotra D, Fedorova OV, et al. Monoclonal antibody against marinobufagenin reverses cardiac fibrosis in rats with chronic renal failure. Am J Hypertens. 2012;25:690–696. doi: 10.1038/ajh.2012.17.
7.
Bagrov AY, Fedorova OV, Dmitrieva RI, Howald WN, Hunter AP, Kuznetsova EA, et al. Characterization of a urinary bufodienolide Na+,K+-ATPase inhibitor in patients after acute myocardial infarction. Hypertension. 1998;31:1097–1103. doi: 10.1161/01.HYP.31.5.1097.
8.
Sibai B, Dekker G, Kupferminc M. Pre-eclampsia. Lancet. 2005;365:785–799. doi: 10.1016/S0140-6736(05)17987-2.
9.
Fedorova OV, Simbirtsev AS, Kolodkin NI, Kotov AY, Agalakova NI, Kashkin VA, et al. Monoclonal antibody to an endogenous bufadienolide, marinobufagenin, reverses preeclampsia-induced Na/K-ATPase inhibition and lowers blood pressure in NaCl-sensitive hypertension. J Hypertens. 2008;26:2414–2425. doi: 10.1097/HJH.0b013e328312c86a.
10.
Kennedy DJ, Vetteth S, Periyasamy SM, Kanj M, Fedorova L, Khouri S, et al. Central role for the cardiotonic steroid marinobufagenin in the pathogenesis of experimental uremic cardiomyopathy. Hypertension. 2006;47:488–495. doi: 10.1161/01.HYP.0000202594.82271.92.
11.
Fedorova OV, Kolodkin NI, Agalakova NI, Lakatta EG, Bagrov AY. Marinobufagenin, an endogenous alpha-1 sodium pump ligand, in hypertensive Dahl salt-sensitive rats. Hypertension. 2001;37(2 pt 2):462–466.
12.
Fedorova OV, Agalakova NI, Talan MI, Lakatta EG, Bagrov AY. Brain ouabain stimulates peripheral marinobufagenin via angiotensin II signalling in NaCl-loaded Dahl-S rats. J Hypertens. 2005;23:1515–1523.
13.
Doris PA. Immunological evidence that the adrenal gland is a source of an endogenous digitalis-like factor. Endocrinology. 1988;123:2440–2444. doi: 10.1210/endo-123-5-2440.
14.
Elkareh J, Kennedy DJ, Yashaswi B, Vetteth S, Shidyak A, Kim EG, et al. Marinobufagenin stimulates fibroblast collagen production and causes fibrosis in experimental uremic cardiomyopathy. Hypertension. 2007;49:215–224. doi: 10.1161/01.HYP.0000252409.36927.05.
15.
Cereijido M, Contreras RG, Shoshani L, Larre I. The Na+-K+-ATPase as self-adhesion molecule and hormone receptor. Am J Physiol Cell Physiol. 2012;302:C473–C481. doi: 10.1152/ajpcell.00083.2011.
16.
Briet M, Schiffrin EL. Aldosterone: effects on the kidney and cardiovascular system. Nat Rev Nephrol. 2010;6:261–273. doi: 10.1038/nrneph.2010.30.
17.
Laurent S, Alivon M, Beaussier H, Boutouyrie P. Aortic stiffness as a tissue biomarker for predicting future cardiovascular events in asymptomatic hypertensive subjects. Ann Med. 2012;44 Suppl 1:S93–S97. doi: 10.3109/07853890.2011.653398.
18.
Payne AH, Hales DB. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr Rev. 2004;25:947–970. doi: 10.1210/er.2003-0030.
19.
Murrell JR, Randall JD, Rosoff J, Zhao JL, Jensen RV, Gullans SR, et al. Endogenous ouabain: upregulation of steroidogenic genes in hypertensive hypothalamus but not adrenal. Circulation. 2005;112:1301–1308. doi: 10.1161/CIRCULATIONAHA.105.554071.
20.
Dmitrieva RI, Bagrov AY, Lalli E, Sassone-Corsi P, Stocco DM, Doris PA. Mammalian bufadienolide is synthesized from cholesterol in the adrenal cortex by a pathway that Is independent of cholesterol side-chain cleavage. Hypertension. 2000;36:442–448.
21.
Javitt NB. Oxysteroids: a new class of steroids with autocrine and paracrine functions. Trends Endocrinol Metab. 2004;15:393–397. doi: 10.1016/j.tem.2004.08.009.
22.
Pikuleva IA. Cytochrome P450s and cholesterol homeostasis. Pharmacol Ther. 2006;112:761–773. doi: 10.1016/j.pharmthera.2006.05.014.
23.
Thomas C, Pellicciari R, Pruzanski M, Auwerx J, Schoonjans K. Targeting bile-acid signalling for metabolic diseases. Nat Rev Drug Discov. 2008;7:678–693. doi: 10.1038/nrd2619.
24.
Javitt NB. Bile acid synthesis from cholesterol: regulatory and auxiliary pathways. FASEB J. 1994;8:1308–1311.
25.
Li J, Daly E, Campioli E, Wabitsch M, Papadopoulos V. De novo synthesis of steroids and oxysterols in adipocytes. J Biol Chem. 2014;289:747–764. doi: 10.1074/jbc.M113.534172.
26.
Nelson ER, Wardell SE, Jasper JS, Park S, Suchindran S, Howe MK, et al. 27-Hydroxycholesterol links hypercholesterolemia and breast cancer pathophysiology. Science. 2013;342:1094–1098. doi: 10.1126/science.1241908.
27.
Uno Y, Hosaka S, Yamazaki H. Identification and analysis of CYP7A1, CYP17A1, CYP20A1, CYP27A1 and CYP51A1 in cynomolgus macaques. J Vet Med Sci. 2014;76:1647–1650. doi: 10.1292/jvms.14-0313.
28.
Dringenberg T, Schwitalla M, Haase M, Scherbaum WA, Willenberg HS. Control of CYP11B2/CYP11B1 expression ratio and consequences for the zonation of the adrenal cortex. Horm Metab Res. 2013;45:81–85. doi: 10.1055/s-0032-1331210.
29.
Hylemon PB, Zhou H, Pandak WM, Ren S, Gil G, Dent P. Bile acids as regulatory molecules. J Lipid Res. 2009;50:1509–1520. doi: 10.1194/jlr.R900007-JLR200.
30.
Norlin M, Wikvall K. Enzymes in the conversion of cholesterol into bile acids. Curr Mol Med. 2007;7:199–218.
31.
Nebert DW, Wikvall K, Miller W. Human cytochromes P450 in health and disease. Philos Trans R Soc Lond B Biol Sci. 2014;368:1–21. doi: 10.1098/rstb.2012.0431.
32.
Lopatin DA, Ailamazian EK, Dmitrieva RI, Shpen VM, Fedorova OV, Doris PA, Bagrov AY. Circulating bufodienolide and cardenolide sodium pump inhibitors in preeclampsia. J Hypertens. 1999;17:1179–1187.
33.
Chen C, Osuch MV. Biosynthesis of bufadienolides–3-beta-hydroxycholanates as precursors in Bufo marinus bufadienolides synthesis. Biochem Pharmacol. 1969;18:1797–1802.
34.
Porto AM, Baralle FE, Gros EG. Biosynthesis of bufadienolides in toads. 3. Experiments with (2- 14 C)mevalonic acid, (20- 14 C)3 -hydroxy-5-pregnen-20-one and (20- 14 C)cholesterol. J Steroid Biochem. 1972;3:11–17.
35.
Pikuleva I, Javitt NB. Novel sterols synthesized via the CYP27A1 metabolic pathway. Arch Biochem Biophys. 2003;420:35–39.
36.
Pikuleva IA, Babiker A, Waterman MR, Björkhem I. Activities of recombinant human cytochrome P450c27 (CYP27) which produce intermediates of alternative bile acid biosynthetic pathways. J Biol Chem. 1998;273:18153–18160.
37.
Chiang JYL. Regulation of bile acid synthesis. Front Biosci. 1998;3:176–193.
38.
Meaney S, Babiker A, Lütjohann D, Diczfalusy U, Axelson M, Björkhem I. On the origin of the cholestenoic acids in human circulation. Steroids. 2003;68:595–601.
39.
Délèze G, Paumgartner G, Karlaganis G, Giger W, Reinhard M, Sidiropoulos D. Bile acid pattern in human amniotic fluid. Eur J Clin Invest. 1978;8:41–45.
40.
Makino I, Sjövall J, Norman A, Strandvik B. Excretion of 3beta-hydroxy-5-cholenoic and 3a-hydroxy-5a-cholanoic acids in urine of infants with biliary atresia. FEBS Lett. 1971;15:161–164.
41.
Fulton IC, Douglas JG, Hutchon DJ, Beckett GJ. Is normal pregnancy cholestatic? Clin Chim Acta. 1983;130:171–176.
42.
Umetani M, Shaul PW. 27-Hydroxycholesterol: the first identified endogenous SERM. Trends Endocrinol Metab. 2011;22:130–135. doi: 10.1016/j.tem.2011.01.003.
43.
Lee WR, Ishikawa T, Umetani M. The interaction between metabolism, cancer and cardiovascular disease, connected by 27-hydroxycholesterol. Clin Lipidol. 2014;9:617–624. doi: 10.2217/clp.14.53.
44.
Trejter M, Hochol A, Tyczewska M, Ziolkowska A, Jopek K, Szyszka M, et al. Sex-related gene expression profiles in the adrenal cortex in the mature rat: microarray analysis with emphasis on genes involved in steroidogenesis. Int J Mol Med. 2015;35:702–714. doi: 10.3892/ijmm.2015.2064.
Information & Authors
Information
Published In
Copyright
© 2015 American Heart Association, Inc.
Versions
You are viewing the most recent version of this article.
History
Received: 28 March 2014
Accepted: 31 August 2015
Published online: 15 September 2015
Published in print: October 2015
Keywords
Subjects
Authors
Disclosures
None.
Sources of Funding
This study was supported by Intramural Research Program, National Institute on Aging, National Institutes of Health.
Metrics & Citations
Metrics
Citations
Download Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Select your manager software from the list below and click Download.
- Adrenal High‐Expressional CYP27A1 Mediates Bile Acid Increase and Functional Impairment in Adult Male Offspring by Prenatal Dexamethasone Exposure, Advanced Science, 12, 14, (2025).https://doi.org/10.1002/advs.202413299
- Onset of bipolar disorder by COVID-19: The roles of endogenous ouabain and the Na,K-ATPase, Journal of Psychiatric Research, 179, (60-68), (2024).https://doi.org/10.1016/j.jpsychires.2024.08.035
- Preeclampsia and transport of ions and small molecules: A literature review, Placenta, 156, (77-91), (2024).https://doi.org/10.1016/j.placenta.2024.09.009
- Antibody to Endogenous Cardiotonic Steroid Reverses Vascular Fibrosis and Restores Vasorelaxation in Chronic Kidney Disease, International Journal of Molecular Sciences, 25, 16, (8896), (2024).https://doi.org/10.3390/ijms25168896
- Identifying toxic effects and metabolic perturbations of Duttaphrynus melanostictus skin extracts in human erythrocytes , Toxicology Research, 13, 3, (2024).https://doi.org/10.1093/toxres/tfae086
- Pharmacogenomic analysis in adrenocortical carcinoma reveals genetic features associated with mitotane sensitivity and potential therapeutics, Frontiers in Endocrinology, 15, (2024).https://doi.org/10.3389/fendo.2024.1365321
- Sensational site: the sodium pump ouabain-binding site and its ligands, American Journal of Physiology-Cell Physiology, 326, 4, (C1120-C1177), (2024).https://doi.org/10.1152/ajpcell.00273.2023
- Neohesperidin Dihydrochalcone Improves Hyperglycemia and Insulin Resistance in Diabetic Zebrafish, ACS Food Science & Technology, 3, 9, (1548-1558), (2023).https://doi.org/10.1021/acsfoodscitech.3c00200
- Endogenous Digitalis-like Factors as a Key Molecule in the Pathophysiology of Pregnancy-Induced Hypertension and a Potential Therapeutic Target in Preeclampsia, International Journal of Molecular Sciences, 24, 16, (12743), (2023).https://doi.org/10.3390/ijms241612743
- New Insights on the Role of Marinobufagenin from Bench to Bedside in Cardiovascular and Kidney Diseases, International Journal of Molecular Sciences, 24, 13, (11186), (2023).https://doi.org/10.3390/ijms241311186
- See more
Loading...
View Options
Login options
Check if you have access through your login credentials or your institution to get full access on this article.
Personal login Institutional LoginPurchase Options
Purchase this article to access the full text.
eLetters(0)
eLetters should relate to an article recently published in the journal and are not a forum for providing unpublished data. Comments are reviewed for appropriate use of tone and language. Comments are not peer-reviewed. Acceptable comments are posted to the journal website only. Comments are not published in an issue and are not indexed in PubMed. Comments should be no longer than 500 words and will only be posted online. References are limited to 10. Authors of the article cited in the comment will be invited to reply, as appropriate.
Comments and feedback on AHA/ASA Scientific Statements and Guidelines should be directed to the AHA/ASA Manuscript Oversight Committee via its Correspondence page.