Association of MicroRNAs and YRNAs With Platelet Function

Small RNA libraries were generated from non-normalized RNA (ranging from 375 pg to 1 ng) extracted from equal volumes of platelet-poor plasma (PPP) and platelet-rich plasma (PRP) from healthy human volunteers. Before library preparation, RNA was spiked with equal amounts of C. elegans miR-39 star (cel-miR-39*) to assist in normalization. Libraries were prepared using the small RNA library preparation kit version 2.0 (Illumina Cambridge Ltd) according to manufacturer’s protocol with limited modifications. In brief, adapters were ligated to the 3′ end and 5′ end of RNA followed by cDNA preparation through reverse transcription. The cDNA was amplified with 12 cycles of PCR. The resulting library was purified using Agencourt Ampure XP beads (Beckman Coulter Inc). Libraries were quantified using Qubit (Life Technologies) and Bioanalyzer (Agilent). Because the total amount of libraries generated was limited, the libraries were mixed together in nonequimolar concentrations and sequenced on HiSeq2000 (Illumina Cambridge Ltd). Traces of the adapter (TGGAATTCTCGGGTGCCAAGG) at the end of the 22 nucleotides for miRNAs were removed using the Trimgalore software, allowing for 10% mismatch and discarding reads that, after adapter removal, became shorter than 15 nucleotides. More than 99.5% of the reads were reduced in size after adapter removal.

RNA isolation, reverse transcription reaction, and preamplification, as well as individual qPCRs for miRNAs, were performed as described previously.^3,4

The expression profile of 92 miRNAs was assessed using custom-made Exiqon locked nucleic acid (LNA) qPCR plates (Exiqon Life Sciences) as described previously.⁴

Plasma samples were obtained from a patient-based cohort of 125 patients with a history of ACS 30 days previously (ST-segment–elevation myocardial infarction, non–ST-segment–elevation myocardial infarction, or unstable angina) who had undergone detailed assessment of platelet function.⁵ The Northern General Hospital, Sheffield, United Kingdom, is the only center providing percutaneous coronary intervention and cardiac surgery services to the surrounding population of ≈1.8 million people, and protocols for antiplatelet therapy are standardized and implemented synchronously across this region. This was a prospective observational study intended to phenotype patients with ACS, including assessment of the effects of changing patterns of P2Y₁₂ inhibitor usage. Treatment algorithms for oral antiplatelet and other secondary prevention therapies in patients with ACS are described by Joshi et al.⁵ All the patients recruited for the study provided informed consent, and the study was approved by the local research ethics committee. The exclusion criteria were <18 years of age, serious comorbidities, end-stage renal failure, and pregnancy or suspected pregnancy. Patients enrolled in the study attended the Clinical Research Facility, Northern General Hospital, Sheffield, United Kingdom, at 30 days after the onset of ACS. Venepuncture with needle and syringe was used to obtain venous blood samples that were anticoagulated with 3.13% trisodium citrate dihydrate (citrate).

The Bruneck study is a population-based, prospective survey of the epidemiology and pathogenesis of atherosclerosis and cardiovascular disease.^3,9 The study protocol was reviewed and approved by the Ethics Committees of Verona and Bolzano, and all participants provided their written informed consent before entering the study. At the 1990 baseline evaluation, the study population comprised an age- and sex-stratified random sample of all inhabitants of Bruneck (125 men and 125 women from each of the fifth through eighth decades of age, all whites). Samples from the year 2000 follow-up were used for this study (n=669). As part of the 2000 follow-up, citrate plasma and serum samples were drawn after an overnight fast and 12 hours of abstinence from smoking. Samples were divided into aliquots and immediately stored at −80°C.

Human platelets and plasma were isolated from 4 healthy volunteers. Whole blood (16 mL) was drawn onto 4 mL of acid–citrate–dextrose (stock solution: 2.5 g sodium citrate, 2.0 g glucose, and 1.5 g citric acid, in 100 mL H₂O) using a 21-gauge needle and 20-mL syringe and centrifuged at 190g for 30 minutes. All centrifugations were performed at room temperature without brake. The supernatant was transferred into a new tube. To prevent platelet activation, 10 nmol/L prostaglandin E1 (Sigma-Aldrich) and 10 μmol/L indomethacin (Sigma-Aldrich) were added. To deplete leukocytes, the supernatant was further centrifuged at 280g for 10 minutes. Leukocyte-depleted PRP (100 μL) was transferred to a 1.5-mL tube for RNA extraction. The remaining volume was transferred to a new tube and centrifuged at 1180g for 10 minutes to pellet platelets. The resulting supernatant was PPP. The platelet pellet was washed twice with modified Tyrode buffer (134 mmol/L NaCl, 2.9 mmol/L KCl, 0.34 mmol/L Na₂HPO₄, 12 mmol/L NaHCO₃, 20 mmol/L HEPES, and 1 mmol/L MgCl₂, pH 7.4; glucose (45 mg/50 mL) was added just before use, and the solution was warmed to 37°C in a water bath). Prostaglandin E1 and indomethacin were added during each wash at the concentrations mentioned above. The solution was centrifuged between washes at 1180g for 10 minutes. The final platelet pellet was resuspended in 1/20 of the volume of original PRP to obtain a 20× stock platelet solution. The 20× platelet solution was then spiked back into the PPP from the same donor to achieve 200%, 100%, 50%, and 5% spike-ins. Immediately after spiking PPP, QIAzol lysis reagent was added and RNA was extracted as described previously.^3,4

Male C57BL/6J mice (Harlan), aged 8 weeks, were treated with cholesterol-conjugated antagomiR constructs (Fidelity Systems, Gaithersburg, MD) or sterile PBS. Sequences were designed to target miR-126-3p (5′-C*G*CAUUAUUACUCACGGU* A*C*G*A*-Chol*T-3′) or to serve as nontargeting control (5′-A*A*GGC AAGCUGACCCUGAA*G*U*U*Chol*T-3′). Intraperitoneal injections were performed on day 0, 1, and 2, in a dose of 25 mg/kg for the platelet function assays in whole blood and 40 mg/kg for the aggregometry experiments carried out in PRP. On day 7, mice were anesthetized using pentobarbital before collection of blood from the inferior vena cava using syringes containing lepirudin (Refludan, 25 μg/mL; Celgene, Windsor, United Kingdom). PRP was isolated as previously described.¹⁰ Briefly, whole blood was diluted 1:1 with HEPES–Tyrode buffer (137 mmol/L NaCl, 20 mmol/L HEPES, 5.6 mmol/L glucose, 1 g/L BSA, 1 mmol/L MgCl₂, 2.7 mmol/L KCl, and 3.3 mmol/L NaH₂PO₄) before centrifugation (100g, 8 minutes, retention time).

Platelet function tests were carried out as described previously.¹¹ Half-area 96-well microtiter plates (Greiner Bio-One, Stonehouse, United Kingdom) were precoated with hydrogenated gelatin (0.75% wt/vol; Sigma, United Kingdom) in PBS to block nonspecific activation of blood. Vehicle or agonist solution (4 μL) was then added to each well: AA (0.03–0.6 mmol/L; Sigma, Poole, United Kingdom), Horm collagen (0.1–3 μg/mL; Nycomed, Linz, Austria), the protease-activated receptor 4 (PAR-4)–activating peptide AYPGKF amide (PAR4-AP, 50–100 μmol/L; Bachem, Bubendorf, Switzerland), and the stable TxA₂ mimetic U46619 (0.1–10 μmol/L; Cayman Chemical Company, Ann Arbor, MI). To each well, 35 μL of PRP or whole blood was added, and the plate was then placed onto a heated plate shaker (Bioshake IQ, Q Instruments, Jena, Germany) at 37°C for 5 minutes mixing at 1200 rpm. Where appropriate, light transmission of each well was determined using a 96-well plate reader (SunriseTM, Tecan, Männedorf, Switzerland) at 595 nm. Alternatively, samples were diluted 1:5 with an acid–citrate–dextrose solution (5 mmol/L glucose, 6.8 mmol/L trisodium citrate, and 3.8 mmol/L citric acid) before individual platelet counts of each were determined by flow cytometry. Platelets were labeled with allophycocyanin-conjugated anti-CD41 (clone eBioMWReg30) for 30 minutes before further dilution 1:50 in PBS containing 0.1% formalin (Sigma, United Kingdom), 0.1% dextrose, and 0.2% BSA and addition of 104 CountBright absolute counting beads (Life Technologies). Labeled, diluted blood was then analyzed using a FACSCalibur flow cytometer (BD Biosciences, Oxford, United Kingdom).

To characterize circulating small RNAs, libraries of small RNAs were generated from PRP and PPP for next-generation sequencing. The presence of platelets and the absence of leukocyte contamination in PRP samples were verified by qPCR for ITGA2B and CD45, respectively (Online Figure IA). The quality of base calls is represented by consecutive boxplots for each position on the 100-nucleotide read (Online Figure IB). The total number of digital reads correlated with the amount of RNA obtained from PPP and PRP (r_p=0.94). Two peaks were observed across all 4 samples, 1 at 22 to 23 nucleotides corresponding to miRNAs and another centered around the 32 to 33 nucleotide range (Figure 1A), which aligned predominantly to RNY4, a noncoding RNA, on chromosome 7. The 25 most abundant small RNAs in each sample are shown in Figure 1B. At a threshold of 0.4 reads per million and without distinguishing between isomiRs, 224 miRNAs were consistently identified in all samples (Online Table I). There was a good correlation for the number of reads per miRNA (Online Figure IC). Coverage of RNY4 was predominantly observed on the 5′ end, with some additional fragments from the 3′ end. Sequences derived from other RNY genes were also detected, although at much lower read counts: for RNY1 and RNY5, like RNY4, mostly, 5′ fragments were found; for RNY3, the 3′ fragments were more abundant (Online Figure II). Two hundred three of 224 miRNAs and both RNY4 fragments were detected at higher levels in PRP than PPP, suggesting that most circulating small RNAs are present in platelets (Online Figure III).

We have previously reported that antiplatelet therapy reduces plasma levels of platelet-related miRNAs, including miR-126 and miR-223.⁴ Ninety-two miRNAs were measured using custom-made Exiqon LNA qPCR plates. The plate layout has been published previously⁴ and is shown in Online Table II. In a principal component analysis, the interindividual variability in plasma miRNA profiles decreased with prolonged platelet inhibition⁴ (Figure 2A), reinforcing the concept that platelet activity is an important determinant of the plasma miRNA pool. To explore how different antiplatelet agents affect plasma miRNAs, the same 92 miRNAs were screened in a closely matched cohort of patients with ACS who were either on ASA only (n=8), ASA+clopidogrel (n=8), ASA+prasugrel (n=8), or ASA+ticagrelor (n=8) for 30 days after the acute event. In the principal component analysis, no clear separation was obtained between the different antiplatelet agents, but the least interpatient variability was observed in the ASA+prasugrel group (Figure 2B).

Next, platelet-related miRNAs (Online Figure IV) and abundant plasma YRNA fragments were measured by individual qPCR assays in the ACS patient cohort who had undergone detailed assessment of platelet function (n=125; Online Table III). The correlations of small RNAs to measurements of platelet function are shown in Figure 3. No correlation was found between miRNA and YRNA levels and optical aggregometry in response to AA or ADP. In contrast, significant associations were obtained for the VASP phosphorylation assays, for example, miR-223 (r_p=0.28; P=0.002), miR-24 (r_p=0.25; P=0.006), miR-191 (r_p=0.24; P=0.009), RNY4 3′ (r_p=0.23; P=0.012), miR-126 (r_p=0.22; P=0.016), and RNY4 5′ (r_p=0.21; P=0.025). For these miRNAs and YRNA fragments, the correlations with the VerifyNow P2Y₁₂ assay were of similar strength (r_p=0.18–0.35), but the statistical power was weaker in view of low numbers, and nominal significance was only noted for miR-126 (r_p=0.35; P=0.033). No associations were obtained for miR-93, miR-106a, miR-146b, and miR-150.

Although all candidate miRNAs were present in platelets (Online Figure IV), some reflected platelet activation better than others. To determine to what extent platelets may contribute to circulating miRNA and YRNA levels, we reconstituted PPP with washed platelets. Platelets were isolated from PRP and spiked back into PPP corresponding to 5%, 50%, 100%, or 200% of the initial volume (Figure 4A). For miR-126 and miR-223, a significant linear increase was observed with increasing platelet content (Figure 4B). As expected, the liver-specific miRNA, miR-122, was not affected by addition of platelets. Notably, miR-126 showed the greatest dependency on platelets in comparison with 21 other miRNAs (Figure 4C). This spike-in experiment provides further evidence for platelets being a major source of circulating miRNAs, including miR-126, which was previously implicated to be of endothelial origin.^12–14 Levels of RNY4 fragments were also strongly affected by addition of platelets (Figure 4C). Unlike miRNAs, however, RNY4 was not associated with argonaute-2 complexes in MEG-01 cells, a human megakaryoblastic cell line (Online Figure V).

MiRNAs and RNY4 fragments were measured in the Bruneck study (n=669) and correlated to the platelet activation markers¹⁵ platelet factor 4 (PF4), pro-platelet basic protein (PPBP), and P-selectin as quantified by ELISA (Figure 5A). Substantial positive correlations of miRNAs and RNY4 fragments with all 3 platelet-activation markers were observed in plasma. These were more pronounced for the platelet-specific proteins PF4 and PPBP than for P-selectin, which is shed from platelets and endothelial cells.^16,17 The liver-specific miRNA, miR-122, and other miRNAs, such as miR-150, showed no or considerably weaker correlations with platelet activation markers (Figure 5A). Accordingly, there was a striking correlation between the platelet dependency of miRNAs in the spike experiment and the correlations of miRNAs with platelet activation markers in the general population (r=0.92–0.94; Figure 5B; Online Figure VI). RNY4 fragments were strongly correlated with platelet-derived plasma miRNAs (Figure 5C), suggesting a common platelet origin.

Although circulating miRNAs have been shown to be affected by disease state, cardiovascular risk factors, and drug treatment, the influence of genetic variability, especially SNPs, on miRNA expression and function is poorly understood. Thus far, only 1 functional SNP has been described for miR-126 (Figure 6A): the primary sequence of human miR-126 contains a SNP (dbSNP: rs4636297) downstream of the pre-miR sequence.⁸ The genotype of this SNP has been shown to affect the processing of pri-miR-126: pri-miR-126 encoded by the major G allele is processed to a lesser extent than pri-miR-126 encoded by the minor A allele. In the Bruneck cohort (Online Table IV), there was a trend toward higher miR-126 levels in individuals homozygous for the minor allele (AA genotype), which facilitates processing of miR-126, compared with the GA+GG genotypes in serum (+4.4%; P=0.050) and in plasma (+6.9%; P=0.099; Online Figure VII). Importantly, the AA genotype was associated with higher plasma levels of platelet activation markers: PF4 (P=0.002), PPBP (P<0.001), and P-selectin (P=0.099; Figure 6B). To compare the effect on platelet proteins to other plasma proteins, we measured 219 proteins, using mass spectrometry for detection of high-abundant proteins (n=84) and proximity extension assays for detection of low-abundant proteins (n=132), as well as ELISA (n=3). Of 61 proteins whose levels are significantly associated with the AA genotype (Online Figure VIII), PPBP and PF4 showed the second and third highest fold change (mean ratios, AA versus GA+GG of 1.49 and 1.47, respectively; Online Table V). The proteins associated with the AA genotype also showed an enrichment of the gene ontology term annotation platelet activation (P=0.019; Online Figure VIII).

The genetic associations of a SNP within miR-126 with parameters of platelet function prompted us to further investigate the role of miR-126 in platelet activation. It has recently been reported that oligonucleotides with a phosphorothioate backbone modification (minimum length of 18 nt) can activate platelets.¹⁸ Thus, we incubated human PRP with fully phosphorothioate-modified LNAs, as well as antagomiRs with 2 and 4 phosphorothioate-modified nucleotides at the 5′ and 3′ ends, respectively. None of the tested oligonucleotides with cholesterol modification induced platelet aggregation (Online Figure IX). Next, C57BL/6J mice were injected with PBS, a control antagomiR or antagomiR-126-3p at 25 mg/kg IP, for 3 consecutive days and euthanized at day 7 (Figure 7A). The knockdown of miR-126 was confirmed in blood samples by qPCR (Online Figure X). Whole blood was treated with different concentrations of agonists: AA, collagen, PAR4-AP, and the TxA₂ analog U46619 (Figure 7B). The aggregation response to AA and U46619 was significantly reduced in platelets from mice treated with antagomiR-126-3p. At antagomiR doses of 25 mg/kg, however, there was no effect on platelet aggregation in response to collagen or PAR4-AP. Thus, we repeated the experiment with a higher antagomiR concentration (40 mg/kg IP). Again, the inhibition of miR-126 was confirmed by qPCR (Online Figure X). To further address the effect of miR-126 in platelets and to minimize a potential influence of other cell types, PRP was used instead of whole blood for platelet aggregation. AntagomiRs against miR-126-3p blocked platelet aggregation induced by 0.6 mmol/L AA (Figure 7C) and led to a significant reduction of aggregation in response to 50 μmol/L PAR4-AP. The attenuated response to 0.3 μg/mL collagen failed to reach statistical significance. No differences in platelet aggregation were observed at higher agonist concentrations of PAR4-AP (100 μmol/L) and collagen (3 μg/mL; data not shown).

To explore potential mechanisms, we measured the expression levels of known miR-126 targets with a role in platelet function alongside platelet-related genes (Online Table VI). We observed reduced expression of the P2Y₁₂ receptor in whole blood of antagomiR-126-3p–treated mice (Figure 8A). In a human megakaryoblastic cell line (MEG-01), mimics or LNA inhibitors of miR-126-3p (Figure 8B and 8C; Online Figure XI) regulated ADAM9, a confirmed target of miR-126 that has been shown to affect collagen-induced platelet aggregation (Figure 8D).¹⁹ Thus, miR-126 alters gene expression in megakaryocytes.

To demonstrate the platelet dependency of our candidate miRNAs, washed platelets were isolated from PRP and spiked back into PPP. This spike-in experiment rules out a cellular contamination, which can hamper direct comparisons between PRP and PPP and provide further evidence that the selected miRNAs, including miR-126, are genuine platelet miRNAs.⁴ Furthermore, we provide evidence that RNY4 fragments in plasma also originate from platelets. YRNA fragments are enriched in exosomes.^20,21 Our next-generation sequencing data confirm that RNY4 fragments are abundant in plasma.²² Unlike miRNAs, however, RNY4 fragments were not present in the Ago2 (argonaute 2 protein) complexes of MEG-01 cells.^23,24 Recently, YRNA fragments were implicated as biomarkers for coronary artery disease.²⁵ Changes in circulating levels were attributed to apoptotic macrophages, which generate and secrete YRNA fragments.²⁵ In contrast, our data suggest that platelets are a major source of circulating YRNA fragments, and cellular origin has to be taken into account if YRNA fragments are considered as potential biomarkers for cardiovascular disease. The function of YRNA fragments remains unknown, but it has been suggested that YRNA fragments, including RNY4 5′, act as small guide RNAs for tRNase Z^L, forming a tRNA-like duplex with a target RNA, thereby enabling its hydrolysis.²⁶ This mechanism has been shown for synthetic target RNAs in vitro, and it remains to be seen whether YRNA fragments can act as guide RNAs for tRNase Z^L in vivo.

Plasma was taken 30 days after the acute event when the inflammation associated with the acute injury has receded and antiplatelet drugs had been administered for a month. Importantly, none of the patients with ACS had received heparin at the time of sampling.^27,28 Levels of miR-126 and other platelet-related miRNAs showed a positive correlation with the VerifyNow P2Y₁₂ and VASP phosphorylation assays. VerifyNow P2Y₁₂ is a commercial assay that uses whole blood to monitor P2Y₁₂ inhibition.²⁹ The VASP assay is considered to be among the most specific assays to monitor P2Y₁₂ inhibition because it does not rely on coactivation of the P2Y₁ receptor by ADP.³⁰ In contrast, optical aggregometry is performed on isolated platelets. Theoretically, aggregometry responses to ADP and the VASP, and Verify Now P2Y₁₂ assays assess the same parameter: P2Y₁₂ receptor activation. However, the variability of the aggregometry results in isolated platelets being higher compared with tests performed in whole blood may explain the loss of associations with plasma miRNAs. Previous studies have suggested that VerifyNow P2Y₁₂ and VASP assays are more discriminating of clopidogrel response and its genetic influences compared with light transmittance aggregometry, and there are only moderate correlations between the different platelet function assays.^30,31 Moreover, aspirin is such a potent inhibitor of the platelet response to AA that any variation between patients is expected to be low. Aspirin inhibits the production of TxA₂. Clopidogrel and prasugrel act by blocking the platelet P2Y₁₂ receptor.^5,29 Thus, their mechanisms are complementary. Clopidogrel and prasugrel are both thienopyridine prodrugs that are converted via hepatic CYP (cytochrome P450 enzyme) isoenzymes to their active metabolite, but prasugrel is more efficiently converted to its active form and so achieves more reliable P2Y₁₂ inhibition. Ticagrelor is a novel P2Y₁₂ receptor antagonist, but its clinical profile, both in terms of efficacy and adverse events, differs from that of the thienopyridine prodrugs.³² Ticagrelor is also supposed to have a dual mode of action as its P2Y₁₂ antagonism is complemented by inhibition of adenosine cell uptake via inhibition of the equilibrative nucleoside transporter 1, thereby increasing extracellular adenosine level and mediating adenosine-receptor activation.³²

It is currently unclear to what extent platelet miRNAs are mechanistically involved in platelet activation. A SNP (rs4636297) in the miR-126 locus has previously been demonstrated to affect the expression of mature miR-126 in cells overexpressing the different variants of pri-miR-126. An effect on endogenous miR-126 levels has not been investigated thus far.⁸ In plasma and serum from the Bruneck cohort, we observed a trend toward higher levels of circulating miR-126 in individuals carrying the minor allele (AA genotype), which facilitates the processing of pri-miR-126. Importantly, the SNP genotype affected the plasma concentrations of 3 platelet activation markers: PF4 (P=0.002), PPBP (P<0.001), and P-selectin (P=0.099) were all positively correlated with the AA genotype. Moreover, for proteins showing an association with the AA genotype in a panel of 219 plasma proteins measured in the Bruneck cohort, there was a significant enrichment of proteins linked to platelet activation (P=0.019; Online Figure VIII). These genetic associations, however, await confirmation in independent cohorts. MiR-126 is abundant in endothelial cells and platelets.³ Although miR-126 is known to be an important regulator of endothelial cell function,^12,33 its role in platelets is unknown. It is, therefore, conceivable that higher miR-126 levels in individuals with the AA genotype influence platelet activity either directly by changing platelet function or indirectly by affecting endothelial cells. Recently, the A allele of SNP rs4636297 has been shown to be associated with sight-threatening diabetic retinopathy in patients with type II diabetes mellitus,³⁴ corroborating the relevance of genetic variability of miRNAs for susceptibility to disease.

Despite numerous reports on miRNAs, surprisingly little is known about their function in platelets. MiR-223 targets the P2Y₁₂ receptor.³⁵ MiR-223–deficient mice form larger thrombi and have a delayed clot retraction compared with wild-type mice.³⁶ Platelets of miR-223–deficient mice display increased aggregation in response to thrombin and collagen but not to fibronectin and the TxA₂ analog U44619. MiR-96 regulates VAMP8/endobrevin, a protein involved in platelet granule secretion that is upregulated in hyper-reactive platelets.³⁷ Our experiments demonstrate that inhibition of miR-126 in mice attenuates platelet aggregation in response to AA, U44619, and PAR4-AP. Collagen-induced platelet aggregation may also be affected, but we did not obtain statistical significance, probably because of low numbers. Platelet aggregation was reduced in whole blood and in PRP. Thus, the involvement of other cell types is less likely. Moreover, MEG-01 cells express miR-126 in abundance, and mimics of miR-126 reduced the expression of ADAM9, whereas inhibition of miR-126 had the opposite effect. ADAM9 is a predicted and experimentally confirmed target of miR-126 that attenuates the adhesion of platelets to collagen.¹⁹ Given its function as a protease of the ADAM family, it may alter the platelet response by cleaving membrane proteins. In whole blood from antagomiR-treated mice, ADAM9 was not differentially expressed. This is expected because ADAM9 is present in many other blood cells that lack miR-126 and therefore are not affected. Notably, the expression of the P2Y₁₂ receptor was reduced in the blood of antagomiR-126-3p–treated mice. P2Y₁₂ levels are much higher in platelets than in leukocytes³⁸ and erythrocytes.³⁹ Thus, the latter finding may, at least in part, explain why platelets from antagomiR-126-3p–treated mice display an attenuated aggregation response: the aggregation responses to strong platelet agonists, such as collagen, thrombin receptor–activating peptides, and particularly, either TxA₂ (generated from AA) or its mimetic U46619, are amplified by ADP, which is released from the platelet dense granules in response to the agonists and activates the P2Y₁₂ receptor. On the other hand, higher concentrations of these agonists or less effective P2Y₁₂ inhibition or deficiency allow a more robust platelet aggregation response. P2Y₁₂ activation may also contribute to the generation of TxA₂ from AA.⁴⁰

Causality cannot be inferred from associations of miRNAs with platelet function tests in patients with ACS. Although recent studies implicated miR-126 in atherogenesis,^41,42 and miR-223 has been used for categorization of patients as responder and nonresponder to the P2Y₁₂ inhibitor clopidogrel,⁴³ larger cohorts with prolonged follow-up are required to determine whether miRNA levels are associated with clinical outcomes in patients with ACS. Because the P2Y₁₂ receptor plays such an important role in platelet reactivity, relationships between the extent of P2Y₁₂ receptor inhibition and miRNA levels have to be further explored in future studies. Similarly, the reported association of a SNP for miR-126 with platelet activation markers requires replication in independent cohorts. MiR-126 is also abundant in endothelial cells, and indirect effects on platelets cannot be excluded. On the other hand, gene expression in MEG-01 cells may be subject to different regulation mechanisms than in primary megakaryocytes and platelets, that is, in undifferentiated MEG-01 cells, P2Y₁₂ expression is not detectable.

Numerous studies have demonstrated the importance of platelet reactivity in the risk of clinical events, such as stent thrombosis after percutaneous coronary intervention or recurrent arterial thrombotic events after ACS. Exciting opportunities exist to further pursue platelet miRNAs as potential biomarkers for treatment response in patients with ACS.⁴⁴ MiRNAs can be measured in frozen samples, which could offer a potential advantage compared with other platelet function tests currently available. Besides their biomarker potential, some miRNAs, such as miR-126 and miR-223,³⁶ may also regulate platelet reactivity.