Skip main navigation

Role of miR-195 in Aortic Aneurysmal Disease

Originally publishedhttps://doi.org/10.1161/CIRCRESAHA.115.304361Circulation Research. 2014;115:857–866

    Abstract

    Rationale:

    Abdominal aortic aneurysms constitute a degenerative process in the aortic wall. Both the miR-29 and miR-15 families have been implicated in regulating the vascular extracellular matrix.

    Objective:

    Our aim was to assess the effect of the miR-15 family on aortic aneurysm development.

    Methods and Results:

    Among the miR-15 family members, miR-195 was differentially expressed in aortas of apolipoprotein E–deficient mice on angiotensin II infusion. Proteomics analysis of the secretome of murine aortic smooth muscle cells, after miR-195 manipulation, revealed that miR-195 targets a cadre of extracellular matrix proteins, including collagens, proteoglycans, elastin, and proteins associated with elastic microfibrils, albeit miR-29b showed a stronger effect, particularly in regulating collagens. Systemic and local administration of cholesterol-conjugated antagomiRs revealed better inhibition of miR-195 compared with miR-29b in the uninjured aorta. However, in apolipoprotein E–deficient mice receiving angiotensin II, silencing of miR-29b, but not miR-195, led to an attenuation of aortic dilation. Higher aortic elastin expression was accompanied by an increase of matrix metalloproteinases 2 and 9 in mice treated with antagomiR-195. In human plasma, an inverse correlation of miR-195 was observed with the presence of abdominal aortic aneurysms and aortic diameter.

    Conclusions:

    We provide the first evidence that miR-195 may contribute to the pathogenesis of aortic aneurysmal disease. Although inhibition of miR-29b proved more effective in preventing aneurysm formation in a preclinical model, miR-195 represents a potent regulator of the aortic extracellular matrix. Notably, plasma levels of miR-195 were reduced in patients with abdominal aortic aneurysms suggesting that microRNAs might serve as a noninvasive biomarker of abdominal aortic aneurysms.

    Introduction

    MicroRNAs are small noncoding RNAs that are involved in post-transcriptional regulation of gene expression.1,2 Recent studies have uncovered pronounced effects of microRNAs on the cardiovascular extracellular matrix (ECM). The miR-29 family has attracted particular attention. It consists of 3 members that exhibit very high homology: miR-29a, miR-29b, and miR-29c. In the heart, dysregulation of miR-29b coincided with ECM remodeling after acute myocardial infarction.3 In the vasculature, inhibition of miR-29 has been consistently shown to reduce aortic aneurysm formation.46 Although there is conflicting evidence for the directionality of the changes of miR-29b expression in angiotensin II (Ang II)–induced murine aneurysms, targeting of elastin and collagens was proposed as the underlying mechanism for the role of miR-29b in aneurysmal disease.47

    Editorial, see p 812

    In This Issue, see p 811

    The ECM is the key structural component determining dilatation and aneurysm formation in the aortic wall.8 Abdominal aortic aneurysms (AAAs) are characterized by loss of elastin and increased collagen turnover. Apart from miR-29, the miR-15 family has been implicated in collagen remodeling and the characteristic postnatal silencing of elastin.9 The miR-15 family consists of 6 highly conserved microRNAs (miR-15a, miR-15b, miR-16-1, miR-16-2, miR-195, and miR-497), which are clustered on 3 separate chromosomes. They have a common seed region (AGCAGCA) and varying degrees of sequence homology in the 3′ region of the mature microRNA.10 Expression of miR-195 and miR-497 is altered in human aortic specimen with evidence of dissection.11 Direct binding of miR-195 to several ECM transcripts was detected in H4 cancer cells.12

    In the present study, we compare the role of miR-29 and miR-15 family members in aortic aneurysm development. Besides biomarker candidates, the regulation of the vascular ECM by microRNAs may reveal novel mechanistic insights and potential therapeutic targets.

    Methods

    An expanded Methods section is available in the Online Data Supplement.

    Clinical Cohorts

    Patients with AAA were identified from the local aneurysm surveillance and screening program. Subjects screened negative for AAA served as controls. The study was approved by the local research ethics committee, and all patients provided written informed consent (REC 07/Q0702/62). Statistical analysis was performed as described previously.13

    Cell Culture

    Smooth muscle cells (SMCs) were isolated by enzymatic digestion of mouse aortas, as described elsewhere,14 and were cultured in DMEM supplemented with 10% FCS, 2 mmol/L l-glutamine, and 100 mg/L gentamicin, at 37°C in a humidified atmosphere of 95% air/5% CO2.

    Transfections

    Cells were plated at 60% to 70% confluency on the day before transfection. Mouse Pre-miR microRNA precursors and microRNA mimics were synthesized by Life Technologies, and Mercury LNA-anti-miRs by Exiqon. The following sequences were used: LNA-195: CCAATATTTCTGTGCTGCT; LNA-29b: ACTGATTTCAAATGGRGCT; LNA-CTL: GTGTAACACGTCTATACGCCCA; Pre-miR-195:UAGCAGCACAGAAAUAUUGGC; Pre-miR-29b: UAGCACCAUUUGAAAUCAGUGUU; Pre-miR-CTL2: sequence not specified. LNA inhibitors and precursor microRNA were transfected at a final concentration of 90 and 20 nmol/L, respectively, using Lipofectamine RMAiMAX (Invitrogen) according to the manufacturer’s recommendations.

    Proteomics Analysis

    SMCs were carefully washed in serum-free medium and then incubated in fresh serum-free medium for 48 hours. Cell debris was removed by centrifugation at 4000 rpm for 10 minutes. The supernatant was transferred into a new tube and stored at −80°C. Samples were subsequently desalted using Zeba Spin desalting columns (Thermo Scientific), vacuum-dried, and resuspended in 60 μL ddH2O. Thirty microliters was used for the proteomic analysis as described previously.15

    AntagomiR Treatment

    Cholesterol-conjugated antagomiR constructs from Fidelity Biosystems were resuspended in sterile PBS at 37°C and stored at −20°C. The sequences of the antagomiR constructs were as follows:

    Control antagomiR: 5′- A*A*GGCAAGCUGACCCUGAA*G*U*U* Chol*T-3′

    AntagomiR-195: 5′- G*C*CAAUAUUUCUGUGCU*G*C*U* Chol*T-3′

    AntagomiR-29b: A*A*CACUGAUUUCAAAUGGUG*C*U*A*-Chol*T-3′

    C57BL6 mice were treated by intraperitoneal injection with a dose of 65 mg/kg per day at days 0, 1, and 2. Mice were euthanized at day 7 to collect aortic tissue.

    Ang II Infusion Model

    Osmotic pumps (Alzet model 2004) containing Ang II (1 μg/kg per minute; Sigma-Aldrich) were implanted in 10-week-old apoE−/− male mice (day 0; C57BL/6J background; Charles River Edinburgh, United Kingdom). Housing and animal care was in accordance with the UK Animals (Scientific Procedures) Act 1986. The antagomiR constructs were injected intraperitoneally at a dose of 80 mg/kg per day on 3 consecutive days (days 1, 2, and 3).

    MR Imaging

    Mice were imaged by MRI before and after implantation of osmotic pumps to obtain aortic and cardiac parameters. The aortic scans were performed using 0.4 mmol/kg of an elastin-specific MR agent.16,17

    Results

    miR-195 in Murine Aortas

    Elastin is the major structural protein that imparts elasticity to blood vessels. Degradation of elastin is an early event in the development of aortic aneurysms. Two microRNA families, miR-29 and miR-15, have been linked to elastin regulation. Differential expression of miR-29b in the aneurysmal aorta has been reported previously.4,5 Here, we investigated the expression of miR-15 family members in a mouse model of aortic dilation. Ang II (1μg/kg per minute) was infused to apoE−/− mice using subcutaneously implanted osmotic minipumps. Among the miR-15 family, only miR-195 was significantly increased (Online Figure I). The miRWALK algorithm predicts putative binding sites for miR-195 and miR-29b in the coding region and the 3′ untranslated region of elastin, respectively. Overexpression of miR-195 as well as miR-29b led to a similar reduction in elastin (Online Figure II). Reporter assays using vectors harboring these sites revealed reduced activity, suggesting that elastin is a direct target of both microRNAs. Although miR-29b has been investigated previously,46 little is known about the role of miR-195 in the vasculature.

    miR-195 and ECM Secretion by SMCs

    To further explore the effect of miR-195 on ECM deposition by SMCs, we performed a proteomic analysis of the conditioned medium from SMCs transfected with pre-miRs and anti-miRs. A total of 129 secreted proteins were identified, with pre-miRs having a more pronounced effect than anti-miRs (Figure 1; Online Tables I and II). A normalized spectral abundance factor coupled with a power law global error model was used to determine the differences in expression. Proteins with a false discovery rate <5% were considered to be significant. Transfection with pre-miR-195 induced differential expression of 87 proteins in the secretome of SMCs. Using different microRNA prediction algorithms (RNA22, miRanda, miRDB, TargetScan, RNAhybrid, PITA, PICTAR, and Diana-microT), only 24 of them were predicted as direct targets.

    Figure 1.

    Figure 1. Proteomic analysis of smooth muscle cell (SMC) secretome. SMCs were transfected with miR-195 precursor, anti-miR-195, or their respective controls and their secretome was analyzed by proteomics. Extracellular matrix proteins identified in the conditioned media and displaying differential expression are depicted in the volcano plots. After miR-195 overexpression (A) and miR-195 inhibition (B). Log2 fold change (FC) is calculated using the normalized spectral abundance factor counts and averaged for 3 biological replicates. FDR indicates false discovery rate.

    Comparison With miR-29b

    Thirty ECM genes and ECM-degrading enzymes were quantified in SMCs after transfection with inhibitors and mimics of miR-195 and miR-29b. As expected, both miR-29b and miR-195 targeted elastin (Eln; Figure 2A). However, the gene expression profiles of extracellular proteins differed. For example, mimics of miR-29b elicited a more robust repression of collagens (col1a1, col1a2, col3a1, col4a1, col4a2, col5a1, col5a2). These results were also validated at the protein level by immunoblotting (Figure 2B). Notably, matrix metalloproteinase (MMP) 2 expression was increased on miR-195 inhibition, whereas targeting miR-29b led to a reduction of MMP9 (Figure 2C) as confirmed by zymography (Figure 2D; Online Figure IID).

    Figure 2.

    Figure 2. Regulation of the extracellular matrix (ECM) by miR-29b and miR-195 in vitro. A, Heat maps illustrate the expression levels of potential ECM targets. A panel of 30 genes of the ECM was assessed by quantitative polymerase chain reaction after microRNA (miR) overexpression (left) and inhibition (right). The highlighted targets were predicted by at least 1 prediction algorithm (RNA22, miRanda, miRDB, TargetScan, RNAhybrid, PITA, PICTAR, and Diana-microT). B, Validation of ECM protein secretion in the conditioned media of transfected smooth muscle cells (SMCs) by Western blot analysis. Part of the corresponding silver-stained gel is shown as loading control in the lowest panel. C, Matrix metalloproteinase (MMP) 2 and MMP9 expression in SMCs after miR inhibition in vitro. Gene expression was normalized to β-actin. *P<0.05 compared with LNA-control. D, Enzymatic activity of gelatinases in the conditioned media of SMCs after miR-29b and miR-195 inhibition, as assessed by zymography. Representative of 3 independent experiments.

    Systemic Inhibition of miR-195 and miR-29b

    To determine the role of miR-29b and miR-195 in ECM gene regulation in vivo, C57Bl wild-type mice were injected with cholesterol-conjugated antagomiRs (65 mg/kg per day; intraperitoneal). AntagomiR-195 was effective in targeting miR-195 expression in the aorta leading to a 60% reduction without affecting other members of the miR-15 family (Figure 3A). Similarly, no off-target effect on the miR-29 family was observed (compared with control antagomiR: 1.17±0.12, 1.13±0.13, and 1.11±0.09 for miR-29a, miR-29b, and miR-29c, respectively; n=5 per group). In vivo inhibition of miR-195 increased expression of elastin (Figure 3B) and of several other ECM genes in the aorta (Figure 3C; Online Figure III). Detailed expression data are presented in Online Figure IV. Surprisingly, the same dose of antagomiR-29b had only marginal effects on miR-29b levels in the uninjured aorta. The observed reduction of miR-29b in the vasculature was small (Figure 3D), and aortic elastin expression was not affected (Figure 3E). A negative correlation between miR-29b levels and ECM genes in the aorta was observed for Col1a1, Col1a2, Col4a2 (Figure 3F), and few other targets (Online Figure V). Detailed expression data are presented in Online Figure VI. In contrast, a marked suppression of miR-29b was observed in the liver. Accordingly, elastin and other ECM genes were upregulated in the liver of mice injected with antagomiR-29b (Online Figure VII). Thus, the uninjured aorta is more susceptive for therapeutic interventions by antagomiR-195 than antagomiR-29b.

    Figure 3.

    Figure 3. Regulation of the extracellular matrix by miR-195 and miR-29b in vivo. A, Expression levels of the miR-15 family in the aorta after antagomiR-195 treatment. B, Elastin expression in the aorta after antagomiR-195 administration. C, Correlation between the miR-195 levels in the aorta and the expression of collagens and elastin as quantified by quantitative polymerase chain reaction. D, Expression levels of the miR-29 family in the aorta after antagomiR-29b treatment. E, Elastin expression in the aorta after antagomiR-29b injection. F, Correlation between the miR-29b levels and the expression of collagens and elastin in the aorta. miR expression was normalized to U6. Gene expression was normalized to β-actin. *P<0.05 compared with antagomiR control. RQ indicates relative quantification.

    Effect of miR-195 and miR-29b on AAA Formation

    To study whether miR-195 may contribute to the pathogenesis of AAA, we compared the effects of miR-195 and miR-29b inhibition on aortic dilation. AntagomiRs were administered systemically as detailed in the Methods section. Uptake of a Cy3-labeled antagomiR was detected in the medial layer of the murine aorta (Online Figure VIII). The total aortic wall area was determined by using an elastin-specific MR contrast agent18 (Figure 4A). A significant decrease in the aortic diameter size was observed in mice treated with antagomiR-29b (n=8; Figure 4B). This was accompanied by enhanced survival compared with control antagomiR- and PBS-injected mice (n=8 each; Figure 4C). Despite significantly elevated expression of elastin and collagens (Online Figure IX), the effect of antagomiR-195 on survival as well as aortic diameter size was not as pronounced (Figure 4B and 4C).

    Figure 4.

    Figure 4. MicroRNA inhibition and angiotensin II (Ang II)–mediated aortic dilatation. Ang II (1 μg/kg per minute) was infused to apoE−/− mice using subcutaneously implanted osmotic minipumps. AntagomiRs (80 mg/kg per day) were injected intraperitoneally for 3 consecutive days. A, MR time-of-flight angiogram of aortas from apoE−/− mice infused with Ang II demonstrating a suprarenal aortic aneurysm. The red line indicates the imaging plane of subsequent performed axial MRI sequences. B, In vivo assessment of the aortic aneurysm diameter after antagomiR-29b or antagomiR-195 treatment (n=8 per group) on days 10 and 35. AntagomiR-control and PBS-injected mice are designated as control group (n=16). *P<0.05 compared with control. C, Kaplan–Meier survival analysis for Ang II–infused mice after injections of antagomiR-29b or antagomiR-195.

    Local Inhibition of miR-195 and miR-29b in Aortic Isografts

    To discern systemic from local effects, we used an aortic isograft model.19 Aortas were harvested, incubated with cholesterol-bound LNA anti-miRs for 2 hours, and then isografted into the carotid artery of recipient mice (Figure 5A). This local administration was sufficient to result in an uptake of the antagomiRs by the aortic tissue, as demonstrated by the incorporation of a Cy3-labeled antagomiR in the outer layers of SMCs (Figure 5B). The grafts were harvested 7 days later and expression levels of microRNAs were determined. In this setting, miR-195 was significantly inhibited, whereas other members of the miR-15 family were largely unaffected (Figure 5C). Local inhibition of miR-195 was accompanied by derepression of MMPs, in particular MMP2, in the aortic wall (Figure 5D). The same dose of LNA-miR-29b did not significantly inhibit miR-29 expression in aortic grafts (data not shown). In vivo inhibition of miR-195 resulted in a derepression of MMPs in all 3 models (Figure 5E), including aortic tissue of Ang II–infused apoE−/− mice (Online Figure X).

    Figure 5.

    Figure 5. Regulation of matrix metalloproteinase (MMP) 2 and MMP9 by miR-195. A, Schematic representation of the aortic isograft model. B, Uptake of a Cy3-labeled antagomiR by the mouse aorta. SMA indicates smooth muscle actin. C, Expression levels of the miR-15 family in the aortic graft after LNA-miR-195 treatment ex vivo. D, Expression of MMP2 and MMP9 in the aortic grafts after microRNA (miR) inhibition, as quantified by quantitative polymerase chain reaction (QPCR). RQ indicates relative quantification. #P<0.05 (ANOVA with Bonferroni post hoc tests for differences to LNA-miR-29b). E, Correlation between the levels of miR-195 in the aorta and the expression of MMP2 and MMP9 as quantified by QPCR. miR expression was normalized to U6. Gene expression was normalized to β-actin. *P<0.05 compared with control (Con).

    miR-195 in Patients With AAA

    Finally, plasma samples were obtained from the local aneurysm surveillance and screening program designed to identify patients with AAAs. Male patients with AAAs and male controls were matched on hypertension and diabetes mellitus (Table). Fifteen other microRNAs, including some previously related to cardiovascular disease, were added for comparison. Statistical analyses were performed using conventional and L1-penalized logistic/linear regression, with the latter being developed to explore associations in presence of high-dimensional and collinear data. miR-195 showed the strongest associations using either a continuous (aortic diameter size; n=44; Figure 6) or a categorical classification of disease (n=22 per group; Figure 7). Other microRNAs displaying significant inverse correlations with aortic diameter size included miR-148a, miR-125b, miR-20a, and miR-340. Expression levels of these 4 microRNAs, however, were highly correlated to miR-195 (Online Table III), and their association with aortic diameter size was attenuated after adjustment for miR-195 (Online Figures XI and XII). Instead, significant associations emerged for miR-133a and miR-145, suggesting that their relation to AAA may be independent of miR-195. The significant inverse associations of miR-195 with the presence of AAA and the aortic diameter was confirmed by extending the analyses to all participants in the program (n=73; Online Table IV; Online Figures XIII and XIV). In comparison to miR-195, miR-29b levels in plasma were low (Ct >32 cycles; Online Figure XV) rendering plasma miR-29b less suitable as a biomarker of AAA.

    Table. Clinical Characteristics of Select Cases and Controls From the Abdominal Aortic Aneurysm Screening Program

    VariableMean (SD) or n (%)P Value
    Cases (n=22)Controls (n=22)
    Age70.8 (6.2)66.7 (1.0)0.008
    Hypertension16 (73%)16 (73%)Matched
    Diabetes mellitus4 (18%)4 (18%)Matched
    Aortic diameter3.9 (0.8)2.1 (0.3)<0.0001
    Smoking status0.072
     Current14 (64%)17 (77%)
     Ex1 (5%)4 (18%)
     Never7 (32%)1 (5%)
    HPL11 (50%)9 (41%)0.500
    COPD5 (23%)1 (5%)0.218
    CAD9 (41%)3 (14%)0.070
    PVD6 (27%)0 (0%)0.031
    Prior CVA4 (18%)0 (0%)0.125
    Prior CABG2 (9%)1 (5%)1.000
    Major surgery9 (41%)4 (18%)0.227
    Malignancy7 (32%)3 (14%)0.289
    BMI27.4 (4.9)26.9 (3.5)0.653
    Antiplatelets12 (55%)9 (41%)0.508
    β-Blockers8 (36%)4 (18%)0.344
    ACE inhibitors9 (41%)6 (27%)0.453
    Statins15 (68%)11 (50%)0.219

    P values were calculated with the paired t test (continuous variables) or exact McNemar test (categorical variables). ACE indicates angiotensin-converting enzyme; BMI, body mass index; CABG, coronary artery bypass grafting; CAD, coronary artery disease; COPD, chronic obstructive pulmonary disease; CVA, cerebral vascular accident; HPL, hyperlipidemia; and PVD, peripheral vascular disease.

    Figure 6.

    Figure 6. MicroRNAs (miRs) associated with aortic diameter. A, L1-penalized linear regression analysis (least absolute shrinkage and selection operator method). The graph shows linear regression coefficients of miRs (y axis) for different levels of penalization (the tuning parameter λ1 escalates beyond 20). Variables withstanding shrinkage up to high λ1 values are those most relevant for disease prediction. B, Linear regression adjusted for age, matched on hypertension and diabetes mellitus (for details see Table and Methods section). Expression levels were normalized to exogenous cel-miR-39 spike-in control.

    Figure 7.

    Figure 7. MicroRNA (miRs) associated with abdominal aortic aneurysm (AAA). A, L1-penalized logistic regression analysis (least absolute shrinkage and selection operator method). The graph shows logistic regression coefficients of miRs (y axis) for different levels of penalization (the tuning parameter λ1). Variables withstanding shrinkage up to high λ1 values are those most relevant for disease prediction. B, Logistic regression adjusted for age, matched on hypertension and diabetes mellitus (for details see Table and Methods section). Expression levels were normalized to exogenous cel-miR-39 spike-in control.

    Discussion

    The principal merits of this study are (1) the measurements of plasma microRNAs in a patient cohort of AAA and (2) the direct comparison of 2 microRNA families known to target elastin in in vitro studies in vascular SMCs and in in vivo studies using 3 different animal models (uninjured aorta and aortic isografts in wild-type mice; Ang II infusion in apoE−/− mice). Although both miR-195 and miR-29b affect elastin in vitro and antagomiRs to miR-195 were more efficient in upregulating aortic elastin expression in vivo, antagomiR treatment to miR-195 did not recapitulate the protective effects of miR-29b inhibition on aneurysm formation. In contrast to miR-29b, silencing of miR-195 induced a derepression of MMPs, which is likely to contribute to the adverse outcome in ECM homeostasis. miR-195, however, emerged as a biomarker candidate for AAA.

    MicroRNAs as Biomarkers

    We have previously performed the first population-based study on circulating microRNAs for type II diabetes mellitus20 and myocardial infarction.13 We also determined the platelet origin of several microRNAs related to cardiovascular disease by subjecting healthy volunteers to limb ischemia/reperfusion injury generated by thigh cuff inflation13 and performing a dose escalation study of platelet inhibition.21 The association of plasma microRNAs and AAA is unclear. In the present study, we measured 16 microRNAs in 73 participants from a local aneurysm surveillance and screening program. Among the most robust changes was miR-195, which dominated the penalized regression analyses for aortic diameter size and categorical disease outcome in terms of association strength. miR-195 belongs to the miR-15 family that consists of highly conserved microRNAs that regulate key processes in cancer, neural, and cardiovascular diseases. miR-195 expression increases in cardiac hypertrophy, and cardiac overexpression of miR-195 resulted in heart failure in transgenic mice.22 To our knowledge this is the first report associating plasma levels of miR-195 with aortic disease.

    Clinical Relevance

    Aortic disease leads to significant morbidity and mortality as well as high economic burden.23,24 There are currently no good blood tests that identify patients with AAA or predict which AAAs are likely to rupture or expand and require surgical intervention. The diameter of the aneurysm is currently the best predictor of rupture, but not always reliable. Better diagnostic tools are urgently needed to identify patients at risk, monitor disease progression, and implement novel therapeutic and preemptive strategies.2527 Identification of those patients with AAAs at risk of subsequent expansion or rupture by a simple cheap noninvasive method of predicting subsequent AAA growth would meet an important clinical need. Once AAA is diagnosed, patients at high risk may be treated with earlier surgical repair to prevent rupture. Conversely, if a simple blood test showed a low risk of disease progression, then patients with significant comorbidity or high surgical risk might be safely kept under surveillance rather than proceed with surgery. Our findings await confirmation in larger cohorts. Thus, their exploratory/hypothesis-generating nature has to be emphasized. Future studies will need to show whether AAA-specific microRNA profiles that characterize aneurysm formation and positive responders to treatment might lead to the development of innovative microRNA-based diagnostic and therapeutic strategies for AAA.

    MicroRNAs and AAA

    Thus far, miR-29b was identified as a pivotal regulator of aortic dilation in an elastase infusion model of experimental AAA in wild-type mice and in an Ang II infusion model in apoE−/− mice.4 Additionally, miR-21 was implicated as a modulator of proliferation and apoptosis of vascular SMCs during development of AAA.28 The age-related increase of miR-29 expression was proposed to render the aorta susceptible to aneurysm development, whereas inhibition of miR-29b, by treatment with LNA-anti-miR-29b, reduced aortic dilation after Ang II infusion in aged mice.5 Similar results were obtained in a model of genetically induced aneurysms in Fibulin-4R/R mice. In Marfan syndrome, a connective tissue disorder that can lead to the development of aortic root aneurysms, expression of miR-29b was increased in the ascending aorta. Inhibition of miR-29b prevented early aneurysm development.6 Thus, several studies suggest a role for miR-29b in aortic aneurysms. Mechanistically, upregulation of elastin,5 increased collagen deposition,4 and suppression of MMP activity were implicated in reducing aortic dilation after miR-29b inhibition.4

    MicroRNA Target Identification

    Herein, we assess the effect of 2 elastin-targeting microRNAs, miR-195 and miR-29b, both in vitro and in vivo. We have previously used proteomics to study the role of miR-29b in cardiac fibrosis.15 We now use proteomic analysis to characterize the secretome of SMCs after manipulation of miR-195 and perform a comparison of the ECM changes induced by miR-195 and miR-29b. Detailed in vitro analyses showed that miR-195 and miR-29b had similar efficiency in targeting elastin. However, miR-29b exerted a more robust effect on ECM deposition by SMCs than miR-195. Collagens, in particular, are more efficiently targeted by mimics to miR-29b than mimics to miR-195. This is consistent with previous findings by Maegdefessel et al4 showing a significant increase in collagen expression and to a lesser extent in elastin content on miR-29 inhibition, although an extensive profiling of ECM genes, as in the present study, was not performed.

    Targeting Efficiency In Vivo

    The targets observed in vitro were further confirmed in vivo using cholesterol-conjugated antagomiRs. When the same doses of antagomiRs were administered systemically to C57Bl mice, antagomiRs to miR-195 proved to be more effective in upregulating elastin expression in the uninjured aorta than antagomiRs to miR-29b. In a separate model of Ang II infusion in apoE−/− mice, the efficiency of antagomiRs against miR-195 and miR-29b was compared with regard to preventing aneurysm formation, decreasing aortic diameter, and improving survival. AntagomiR-29b was superior to antagomiR-195 in reducing aortic dilation and increasing survival in Ang II–infused apoE−/− mice. This therapeutic benefit cannot be solely attributed to the derepression of aortic elastin or collagens: both occurred also after miR-195 inhibition; moreover, targeting of miR-29b in murine aortas was less efficient compared with miR-195, with systemic or local delivery of antagomiRs or anti-miRs, respectively.

    ECM Degradation in AAA

    Considerable evidence from human and experimental animal models of AAA points toward a prominent role for MMP2 and MMP9 in AAA development. Elevated levels of MMP2 and MMP9 activity were reported in the aneurysmal part of the mouse aorta after Ang II infusion.29 MMP2 and MMP9 are 2 key proteases in ECM destruction, with MMP2 being unique in its ability to target both elastin and fibrillar collagen.30 MMP9, on the contrary, is the most abundant gelatinolytic MMP in AAA tissue and is secreted in high levels from AAA explants. MMP9-deficient mice displayed preservation of the elastic lamellae of the aortic wall and were shown to be resistant to aneurysm development.31 Our observation that miR-195 inhibition induced MMP activity offers a plausible explanation for the different therapeutic outcome compared with silencing miR-29b.

    Conclusions

    In this study, the therapeutic efficacy of miR-195 and miR-29b was compared with regard to regulating ECM and ECM-associated proteins in vitro and in vivo. Additionally, we provide proof-of-principle that microRNAs might have clinical utility as biomarkers for AAA by observing an inverse relationship between plasma miR-195 and the presence of AAA and aortic diameter.

    Nonstandard Abbreviations and Acronyms

    AAA

    abdominal aortic aneurysm

    Ang II

    angiotensin II

    ECM

    extracellular matrix

    MMP

    matrix metalloproteinase

    SMC

    smooth muscle cell

    Footnotes

    In August, 2014, the average time from submission to first decision for all original research papers submitted to Circulation Research was 13.55 days.

    The online-only Data Supplement is available with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.115.304361/-/DC1.

    Correspondence to Dr Anna Zampetaki or Prof Manuel Mayr, King’s British Heart Foundation Centre, King’s College London, 125 Coldharbour Lane, London SE59NU, United Kingdom. E-mail or

    References

    • 1. Bartel DP. MicroRNAs: target recognition and regulatory functions.Cell. 2009; 136:215–233.CrossrefMedlineGoogle Scholar
    • 2. Liu N, Olson EN. MicroRNA regulatory networks in cardiovascular development.Dev Cell. 2010; 18:510–525.CrossrefMedlineGoogle Scholar
    • 3. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA, Olson EN. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis.Proc Natl Acad Sci U S A. 2008; 105:13027–13032.CrossrefMedlineGoogle Scholar
    • 4. Maegdefessel L, Azuma J, Toh R, Merk DR, Deng A, Chin JT, Raaz U, Schoelmerich AM, Raiesdana A, Leeper NJ, McConnell MV, Dalman RL, Spin JM, Tsao PS. Inhibition of microRNA-29b reduces murine abdominal aortic aneurysm development.J Clin Invest. 2012; 122:497–506.CrossrefMedlineGoogle Scholar
    • 5. Boon RA, Seeger T, Heydt S, Fischer A, Hergenreider E, Horrevoets AJ, Vinciguerra M, Rosenthal N, Sciacca S, Pilato M, van Heijningen P, Essers J, Brandes RP, Zeiher AM, Dimmeler S. MicroRNA-29 in aortic dilation: implications for aneurysm formation.Circ Res. 2011; 109:1115–1119.LinkGoogle Scholar
    • 6. Merk DR, Chin JT, Dake BA, Maegdefessel L, Miller MO, Kimura N, Tsao PS, Iosef C, Berry GJ, Mohr FW, Spin JM, Alvira CM, Robbins RC, Fischbein MP. miR-29b participates in early aneurysm development in Marfan syndrome.Circ Res. 2012; 110:312–324.LinkGoogle Scholar
    • 7. Zhang P, Huang A, Ferruzzi J, Mecham RP, Starcher BC, Tellides G, Humphrey JD, Giordano FJ, Niklason LE, Sessa WC. Inhibition of microRNA-29 enhances elastin levels in cells haploinsufficient for elastin and in bioengineered vessels–brief report.Arterioscler Thromb Vasc Biol. 2012; 32:756–759.LinkGoogle Scholar
    • 8. Daugherty A, Cassis LA. Mechanisms of abdominal aortic aneurysm formation.Curr Atheroscler Rep. 2002; 4:222–227.CrossrefMedlineGoogle Scholar
    • 9. Ott CE, Grünhagen J, Jäger M, Horbelt D, Schwill S, Kallenbach K, Guo G, Manke T, Knaus P, Mundlos S, Robinson PN. MicroRNAs differentially expressed in postnatal aortic development downregulate elastin via 3’ UTR and coding-sequence binding sites.PLoS One. 2011; 6:e16250.CrossrefMedlineGoogle Scholar
    • 10. Porrello ER, Johnson BA, Aurora AB, Simpson E, Nam YJ, Matkovich SJ, Dorn GW, van Rooij E, Olson EN. MiR-15 family regulates postnatal mitotic arrest of cardiomyocytes.Circ Res. 2011; 109:670–679.LinkGoogle Scholar
    • 11. Liao M, Zou S, Weng J, Hou L, Yang L, Zhao Z, Bao J, Jing Z. A microRNA profile comparison between thoracic aortic dissection and normal thoracic aorta indicates the potential role of microRNAs in contributing to thoracic aortic dissection pathogenesis.J Vasc Surg. 2011; 53:1341–1349.e3.CrossrefMedlineGoogle Scholar
    • 12. Nelson PT, Wang WX, Mao G, Wilfred BR, Xie K, Jennings MH, Gao Z, Wang X. Specific sequence determinants of miR-15/107 microRNA gene group targets.Nucleic Acids Res. 2011; 39:8163–8172.CrossrefMedlineGoogle Scholar
    • 13. Zampetaki A, Willeit P, Tilling L, Drozdov I, Prokopi M, Renard JM, Mayr A, Weger S, Schett G, Shah A, Boulanger CM, Willeit J, Chowienczyk PJ, Kiechl S, Mayr M. Prospective study on circulating microRNAs and risk of myocardial infarction.J Am Coll Cardiol. 2012; 60:290–299.CrossrefMedlineGoogle Scholar
    • 14. Zampetaki A, Zhang Z, Hu Y, Xu Q. Biomechanical stress induces IL-6 expression in smooth muscle cells via Ras/Rac1-p38 MAPK-NF-kappaB signaling pathways.Am J Physiol Heart Circ Physiol. 2005; 288:H2946–H2954.CrossrefMedlineGoogle Scholar
    • 15. Abonnenc M, Nabeebaccus AA, Mayr U, et al. Extracellular matrix secretion by cardiac fibroblasts: role of microRNA-29b and microRNA-30c.Circ Res. 2013; 113:1138–1147.LinkGoogle Scholar
    • 16. Makowski MR, Wiethoff AJ, Blume U, Cuello F, Warley A, Jansen CH, Nagel E, Razavi R, Onthank DC, Cesati RR, Marber MS, Schaeffter T, Smith A, Robinson SP, Botnar RM. Assessment of atherosclerotic plaque burden with an elastin-specific magnetic resonance contrast agent.Nat Med. 2011; 17:383–388.CrossrefMedlineGoogle Scholar
    • 17. Makowski MR, Preissel A, von Bary C, Warley A, Schachoff S, Keithan A, Cesati RR, Onthank DC, Schwaiger M, Robinson SP, Botnar RM. Three-dimensional imaging of the aortic vessel wall using an elastin-specific magnetic resonance contrast agent.Invest Radiol. 2012; 47:438–444.CrossrefMedlineGoogle Scholar
    • 18. Botnar RM, Wiethoff AJ, Ebersberger U, Lacerda S, Blume U, Warley A, Jansen CH, Onthank DC, Cesati RR, Razavi R, Marber MS, Hamm B, Schaeffter T, Robinson SP, Makowski MR. In vivo assessment of aortic aneurysm wall integrity using elastin-specific molecular magnetic resonance imaging.Circ Cardiovasc Imaging. 2014; 7:679–689.LinkGoogle Scholar
    • 19. Zampetaki A, Zeng L, Margariti A, Xiao Q, Li H, Zhang Z, Pepe AE, Wang G, Habi O, deFalco E, Cockerill G, Mason JC, Hu Y, Xu Q. Histone deacetylase 3 is critical in endothelial survival and atherosclerosis development in response to disturbed flow.Circulation. 2010; 121:132–142.LinkGoogle Scholar
    • 20. Zampetaki A, Kiechl S, Drozdov I, Willeit P, Mayr U, Prokopi M, Mayr A, Weger S, Oberhollenzer F, Bonora E, Shah A, Willeit J, Mayr M. Plasma microRNA profiling reveals loss of endothelial miR-126 and other microRNAs in type 2 diabetes.Circ Res. 2010; 107:810–817.LinkGoogle Scholar
    • 21. Willeit P, Zampetaki A, Dudek K, et al. Circulating microRNAs as novel biomarkers for platelet activation.Circ Res. 2013; 112:595–600.LinkGoogle Scholar
    • 22. van Rooij E, Sutherland LB, Liu N, Williams AH, McAnally J, Gerard RD, Richardson JA, Olson EN. A signature pattern of stress-responsive microRNAs that can evoke cardiac hypertrophy and heart failure.Proc Natl Acad Sci U S A. 2006; 103:18255–18260.CrossrefMedlineGoogle Scholar
    • 23. Lederle FA, Wilson SE, Johnson GR, et al; Aneurysm Detection and Management Veterans Affairs Cooperative Study Group. Immediate repair compared with surveillance of small abdominal aortic aneurysms.N Engl J Med. 2002; 346:1437–1444.CrossrefMedlineGoogle Scholar
    • 24. Golledge J, Muller J, Daugherty A, Norman P. Abdominal aortic aneurysm: pathogenesis and implications for management.Arterioscler Thromb Vasc Biol. 2006; 26:2605–2613.LinkGoogle Scholar
    • 25. Hellenthal FA, Buurman WA, Wodzig WK, Schurink GW. Biomarkers of AAA progression. Part 1: extracellular matrix degeneration.Nat Rev Cardiol. 2009; 6:464–474.CrossrefMedlineGoogle Scholar
    • 26. Hellenthal FA, Buurman WA, Wodzig WK, Schurink GW. Biomarkers of abdominal aortic aneurysm progression. Part 2: inflammation.Nat Rev Cardiol. 2009; 6:543–552.CrossrefMedlineGoogle Scholar
    • 27. Klink A, Hyafil F, Rudd J, et al. Diagnostic and therapeutic strategies for small abdominal aortic aneurysms.Nat Rev Cardiol. 2011; 8:338–347.CrossrefMedlineGoogle Scholar
    • 28. Maegdefessel L, Azuma J, Toh R, Deng A, Merk DR, Raiesdana A, Leeper NJ, Raaz U, Schoelmerich AM, McConnell MV, Dalman RL, Spin JM, Tsao PS. MicroRNA-21 blocks abdominal aortic aneurysm development and nicotine-augmented expansion.Sci Transl Med. 2012; 4:122ra22.CrossrefMedlineGoogle Scholar
    • 29. Deng GG, Martin-McNulty B, Sukovich DA, Freay A, Halks-Miller M, Thinnes T, Loskutoff DJ, Carmeliet P, Dole WP, Wang YX. Urokinase-type plasminogen activator plays a critical role in angiotensin II-induced abdominal aortic aneurysm.Circ Res. 2003; 92:510–517.LinkGoogle Scholar
    • 30. Aimes RT, Quigley JP. Matrix metalloproteinase-2 is an interstitial collagenase. Inhibitor-free enzyme catalyzes the cleavage of collagen fibrils and soluble native type I collagen generating the specific ¾- and ¼-length fragments.J Biol Chem. 1995; 270:5872–5876.CrossrefMedlineGoogle Scholar
    • 31. Pyo R, Lee JK, Shipley JM, Curci JA, Mao D, Ziporin SJ, Ennis TL, Shapiro SD, Senior RM, Thompson RW. Targeted gene disruption of matrix metalloproteinase-9 (gelatinase B) suppresses development of experimental abdominal aortic aneurysms.J Clin Invest. 2000; 105:1641–1649.CrossrefMedlineGoogle Scholar

    Novelty and Significance

    What Is Known?

    • miR-29b and miR-195 have been shown to suppress expression of elastin and collagens.

    • Inhibition of miR-29b protects against aortic aneurysm development and its expansion in mice.

    What New Information Does This Article Contribute?

    • Inhibition of miR-195 increases the expression of elastin in the murine aorta.

    • AntagomiR treatment to miR-195 does not recapitulate the protective effects of miR-29b inhibition on aortic dilatation.

    • Unlike miR-29b, silencing of miR-195 is associated with a derepression of matrix metalloproteinases.

    • In humans, plasma levels of miR-195 are inversely associated with the aortic diameter and the presence of AAAs.

    We assessed the effect of 2 elastin-targeting microRNAs, miR-195 and miR-29b, both in vitro and in vivo. We found that miR-195 regulates extracellular matrix deposition and that its plasma levels were associated with AAAs. There are currently no validated biomarkers to identify patients with AAA or predict which AAAs are likely to rupture or expand and require surgical intervention. The diameter of the aneurysm is currently the best predictor of rupture but not always reliable. Studies in larger cohorts are needed to establish whether plasma microRNA signatures can identify patients with AAA at high risk of expansion or rupture.

    eLetters(0)

    eLetters should relate to an article recently published in the journal and are not a forum for providing unpublished data. Comments are reviewed for appropriate use of tone and language. Comments are not peer-reviewed. Acceptable comments are posted to the journal website only. Comments are not published in an issue and are not indexed in PubMed. Comments should be no longer than 500 words and will only be posted online. References are limited to 10. Authors of the article cited in the comment will be invited to reply, as appropriate.

    Comments and feedback on AHA/ASA Scientific Statements and Guidelines should be directed to the AHA/ASA Manuscript Oversight Committee via its Correspondence page.