Skip main navigation

The (Pro)Renin Receptor

Site-Specific and Functional Linkage to the Vacuolar H+-ATPase in the Kidney
Originally publishedhttps://doi.org/10.1161/HYPERTENSIONAHA.109.128645Hypertension. 2009;54:261–269

Abstract

The (pro)renin receptor ([P]RR) is a transmembrane protein that binds both renin and prorenin with high affinity, increasing the catalytic cleavage of angiotensinogen and signaling intracellularly through mitogen-activated protein kinase activation. Although initially reported as having no homology with any known membrane protein, other studies have suggested that the (P)RR is an accessory protein, named ATP6ap2, that associates with the vacuolar H+-ATPase, a key mediator of final urinary acidification. Using in situ hybridization, immunohistochemistry, and electron microscopy, together with serial sections stained with nephron segment–specific markers, we found that (P)RR mRNA and protein were predominantly expressed in collecting ducts and in the distal nephron. Within collecting ducts, the (P)RR was most abundant in microvilli at the apical surface of A-type intercalated cells. Dual-staining immunofluorescence demonstrated colocalization of the (P)RR with the B1/2 subunit of the vacuolar H+-ATPase, the ion exchanger that secretes H+ ions into the urinary space and that associates with an accessory subunit homologous to the (P)RR. In collecting duct/distal tubule lineage Madin-Darby canine kidney cells, extracellular signal–regulated kinase 1/2 phosphorylation, induced by either renin or prorenin, was attenuated by the selective vacuolar H+-ATPase inhibitor bafilomycin. The predominant expression of the (P)RR at the apex of acid-secreting cells in the collecting duct, along with its colocalization and homology with an accessory protein of the vacuolar H+-ATPase, suggests that the (P)RR may function primarily in distal nephron H+ transport, recently noted to be, at least in part, an angiotensin II–dependent phenomenon.

A little more than a decade ago, the binding characteristics and activity of a specific renin receptor in cultured mesangial cells were reported.1 This was followed in 2002 by the identification of an apparently novel, 350 amino acid, single-transmembrane protein that binds both renin and prorenin with high affinity.2 Ligand binding to this (pro)renin receptor ([P]RR) induced a 4-fold increase in the catalytic cleavage of angiotensinogen, as well as stimulating intracellular signaling, with activation of mitogen-activated protein kinases extracellular signal–regulated kinase (ERK) 1/22 and induction of transforming growth factor-β expression.3 The existence of a (P)RR not only expanded our understanding of the physiology of the renin-angiotensin system (RAS) but also provided insight into the potential pathogenetic role of prorenin, the enzymatically inactive zymogen that is elevated in disease states, eg, diabetes mellitus, where it predicts the subsequent development of nephropathy and retinopathy.4

Given its localization to the mesangium, its actions in augmenting local angiotensin II production, and its ability to increase mesangial transforming growth factor-β production, the (P)RR has understandably been implicated in the pathogenesis of kidney disease.5 However, despite the appeal, it has been difficult to reconcile this view of the (P)RR with several other experimental findings regarding not only its pathogenetic role but also its site-specific localization in the kidney and its homology with other proteins. For instance, given the purported pathogenetic role of the (P)RR, the increased abundance of renin that follows the use of angiotensin-converting enzyme inhibitors and angiotensin receptor blockers might be expected to be pathogenetic, yet these classes of drugs have been shown repeatedly to be renoprotective. Second, although the (P)RR was initially localized to the glomerular mesangium and arterial media but not tubules,2 subsequent reports indicated that it is found predominantly in distal tubules6,7 and collecting ducts8 of rodent and human kidneys. Third, although initially reported as having no homology with any known membrane protein,2 database interrogation shows that the (P)RR is identical to 2 other proteins: CAPER (endoplasmic reticulum–localized type 1 transmembrane adaptor precursor) and ATPase, H+ transporting, lysosomal accessory protein 2 (ATP6ap2),9–13 a protein that associates with the vacuolar H+-ATPase.14 Although the vacuolar H+-ATPase is expressed on the membranes of intracellular organelles, it is also found in striking abundance at the apical surface of collecting duct A–type intercalated cells (ICs) where it functions to expel protons into the tubular lumen, thereby regulating final urinary acidification.15

In the setting of the above controversies, we considered that, rather than having a primarily pathogenetic role in the kidney, the (P)RR may be more related to ion transport by the vacuolar H+-ATPase system. Accordingly, we sought to determine the precise localization of the (P)RR in the kidney and its functional relationship with the vacuolar H+-ATPase.

Methods

Animals

Localization of the (P)RR in the rat kidney was performed in Sprague-Dawley rats (6 male and 4 female) at 12 weeks of age (please see the online Data Supplement at http://hyper.ahajournals.org). All of the experiments adhered to the guidelines of the local animal welfare and ethics committees.

Human Kidney Tissue

Tissue was obtained from the macroscopically normal-appearing renal cortex of 6 patients who had undergone nephrectomy for renal cell carcinoma. Sections were taken distant from the tumor site and showed no pathological abnormalities by light microscopy. In all 6 cases, plasma creatinine and urine protein excretion were normal, and none had a history of hypertension or diabetes mellitus. All of the patients gave informed consent, and the study was performed in accordance with the Declaration of Helsinki.

33P in Situ Hybridization

Synthesis of 33P-labeled riboprobes and in situ hybridization were performed as described previously (please see the online Data Supplement).16,17

Digoxigenin In Situ Hybridization

Riboprobes were labeled with digoxigenin during RNA transcription using a digoxigenin RNA labeling mix (Roche), and in situ hybridization was performed as described previously (please see the online Data Supplement).16

Immunohistochemistry

Immunohistochemistry was performed as reported previously.16,17 For identification of the (P)RR, sections were incubated with specific goat primary polyclonal antiserum to ATP6IP2/renin receptor (AB5959, Abcam). Collecting ducts were recognized by immunostaining for aquaporin 2 (AQP2; Abcam), which is expressed in principal cells.18 Distal convoluted tubules were identified by the presence of thiazide-sensitive Na-Cl cotransporter (TSC; Chemicon).19 Immunostaining for epidermal growth factor (EGF; Biomedical Technologies) was used to label the entire distal nephron in the human kidney.20,21 A-ICs were recognized by immunostaining for anion exchanger 1 (Chemicon).22

Immunogold Electron Microscopy

Immunogold electron microscopy was performed on a Philips CM100 transmission electron microscope (Newcastle University) as described in the online Data Supplement. The density of labeling was expressed as the number of gold particles per unit area of cell cytoplasm (particles per micrometer squared).23

Immunofluorescence and Colocalization Coefficient

Immunofluorescence microscopy was performed as described in the online Data Supplement. Individual cells were processed by Image J version 1.39 (from the National Institutes of Health and available at http://rsb.info.nih.gov/ij/) using the JACoP colocalization algorithm.24 Data represent 22 individual cells taken from 3 different fields.

ERK 1 and 2 Phosphorylation

Cultured Madin-Darby canine kidney (MDCK) cells (please see the online Data Supplement) were preincubated with the angiotensin II type 1 receptor blocker losartan (10 μmol/L) and the angiotensin II type 2 receptor blocker PD123319 (10 μmol/L) for 30 minutes before treatment with either human recombinant renin (Cayman Chemical) or human recombinant prorenin (Cayman Chemical) for 10 minutes.25 (P)RR knockdown was induced by preincubating cells with 100 pmol/L of (P)RR Stealth small interfering RNA (siRNA) for 48 hours, as described previously.3,26 Vacuolar H+-ATPase inhibition was achieved with the plecomacrolide antibiotic bafilomycin that selectively inhibits the vacuolar H+-ATPase by interacting with the cytoplasmic core of this receptor.27 MDCK cells were preincubated with bafilomycin (1 μmol/L; A.G. Scientific Inc) for 30 minutes, in the presence of losartan and PD123319, as described above. Cells were then incubated with either renin or prorenin (20 pmol/L) for 10 minutes, as described.

RNA Isolation, cDNA Synthesis, Protein Extraction, and Western Blotting

Sample preparation was performed according to the online Data Supplement. To confirm specificity of the commercial (P)RR antibody, a peptide with the amino acid sequence SIIYRMTNQKIRMD was synthesized (Bio Basic Inc), identical to that used in generating the polyclonal antibody. The (P)RR antibody was incubated with a ×10 concentration (5 mg/mL) of the peptide for 2 hours at 37°C before immunolabeling.

Real-Time PCR

Primer and probe sequences were as follows: 18S, forward TCGAGGCCCTGTAATTGGAA, reverse CCCTCCAATGGATCCTCGTT, probe AGTCCACTTTAAATCCTT; (P)RR, forward GCATTGTCCATGGGCTTCTC, reverse TAGCCCGAGGACGATGGAAT, probe ACCTTTCTTGGCCAGGAC (please see the online Data Supplement).

Statistics

Data are expressed as mean±SEM, and statistical significance was determined by 1-way ANOVA or Student t test as appropriate. A P<0.05 was considered statistically significant.

Results

Abundant (P)RR in Rat Kidney Collecting Ducts

To investigate the renal distribution of (P)RR mRNA, we first performed both 33P and digoxigenin-labeled in situ hybridization in rat kidneys. Bright- and dark-field light microscopic examination of emulsion-dipped 33P kidney sections revealed abundant transcript within the collecting ducts, with the magnitude of expression greatest in the outer medulla when compared with either the cortex or the inner medulla (Figure 1A and 1B and Figure S1 and S2, available in the online Data Supplement). (P)RR mRNA was also readily apparent in collecting ducts after digoxigenin-labeled in situ hybridization, although, when compared with sense controls, lower levels of transcript were still evident in other renal structures, including glomeruli, proximal tubules, and arteries (Figure 1C and 1D).

Figure 1. In situ hybridization for (P)RR in rat kidney sections. A, Emulsion-dipped kidney section after 33P in situ hybridization showing (P)RR within the cortical collecting ducts (CD). Inset, 33P-labeled (P)RR mRNA within a cortical collecting duct. B, 33P sense control (A and B, original magnification, ×400). C, Digoxigenin in situ hybridization for (P)RR in rat kidney. D, Digoxigenin sense control. (C and D, original magnification, ×160).

For localization of the (P)RR protein, a commercially available polyclonal antibody generated against the 14 C-terminal amino acids of the protein was used. Immunoblotting of rat kidney homogenates showed that the antibody detected the full (P)RR protein (≈40-kDa molecular mass; Figure S3). Preincubation of the antibody with the immunizing peptide completely prevented protein binding when assessed by either Western blot or immunohistochemistry (Figure S3).

To specifically localize the sites of (P)RR transcription and translation, we next performed nephron segment–specific immunostaining in consecutively cut kidney sections. The predominant sites of (P)RR mRNA and protein colocalized with structures that immunostained for AQP2, indicative of collecting duct expression. In contrast, although (P)RR mRNA and protein were also present within cells that stained positively for the distal convoluted tubule marker TSC, expression was much lower than that seen in the collecting ducts (Figure 2).

Figure 2. Consecutive rat kidney sections (A–C and D–F) showing predominant (P)RR expression within the collecting ducts. A, Digoxigenin-labeled in situ hybridization for (P)RR. D, Immunohistochemistry for (P)RR. B, Immunohistochemistry for AQP2, which stains collecting duct (CD) principal cells. C, Immunohistochemistry for TSC, which stains distal convoluted tubules (D). E, Immunohistochemistry for AQP2. F, Immunohistochemistry for TSC. (Each original magnification, ×160.)

Expression of the (P)RR in the Distal Nephron in Human Kidney

Having demonstrated abundant (P)RR within the collecting ducts of rat kidneys, we next sought to determine its expression within human kidney tissue. A digoxigenin-labeled riboprobe directed at a 470-bp N-terminal segment of the human (P)RR and the same polyclonal antibody described above were used in formalin-fixed, paraffin-embedded human nephrectomy tissue, together with nephron segment–specific immunostaining. As observed in rat kidney, although detectable throughout the nephron, both (P)RR protein and mRNA were present in abundance within the collecting ducts. However, in human kidney tissue (P)RR was also highly expressed in distal convoluted tubules (TSC-positive) and distal tubules (AQP2-negative and TSC-negative but staining positively for EGF; Figure 3).

Figure 3. Human kidney (nephrectomy) sections showing distribution of (P)RR throughout the distal nephron in 2 sets of serial sections (A through D and E through H). A, In situ hybridization for (P)RR. B, Immunohistochemistry for AQP2, which stains collecting duct (CD) principal cells. C, Immunohistochemistry for TSC, which stains distal convoluted tubules (DCT). D, Immunohistochemistry for EGF. EGF is expressed throughout the distal nephron; therefore, structures staining positively for EGF but negatively for AQP2 and TSC are distal tubules (D). E, Immunohistochemistry for (P)RR. F, Immunohistochemistry for AQP2. G, Immunohistochemistry for TSC. H, Immunohistochemistry for EGF. (Each original magnification, ×160.)

Localization of the (P)RR to Rat Kidney Intercalated A Cells

Collecting ducts contain 2 main cell types: principal cells, which participate in salt and water balance and possess the water channel protein AQP2 on their apical surfaces, and IC, which are involved in acid-base homeostasis. Subtypes of ICs may be further distinguished according to the presence of the vacuolar H+-ATPase on their apical (A-IC) or basolateral (B–IC) surfaces, with a proportion of cells demonstrating a bipolar pattern of distribution. Within rat kidney collecting ducts, ≈50% of cells showed intense hybridization for (P)RR mRNA. Using serial sections that were alternately probed for (P)RR mRNA and AQP2 protein, we sought to determine which type of collecting duct cell accounted for this. Cells that stained strongly for AQP2 (principal cells) had low levels of (P)RR mRNA, whereas IC (AQP2-negative) were those that demonstrated intense hybridization of digoxigenin-labeled riboprobe (Figure 4A and 4B). Alternate serial sections labeled by (P)RR digoxigenin in situ hybridization and immunohistochemistry confirmed that cells with high levels of (P)RR mRNA were also those that stained strongly with the (P)RR antibody (Figure 4C and 4D). Immunohistochemistry on consecutively cut rat kidney sections stained for the (P)RR and anion exchanger 1, a Cl/HCO3 exchanger also known as band 3 and present on the basolateral surface of A-ICs, demonstrated an abundance of (P)RR protein localized to the luminal border of A-IC (Figure 5).

Figure 4. (P)RR expression within rat kidney collecting duct cells. A and B are consecutive kidney sections after immunostaining for AQP2 (A) and after digoxigenin in situ hybridization for (P)RR (B). C and D show consecutive kidney sections after digoxigenin in situ hybridization for (P)RR (C) and after immunostaining for (P)RR (D). (Each original magnification, ×1000). In a substantial number of cells, (P)RR protein was notable at the luminal surface (arrow).

Figure 5. Consecutive rat kidney sections stained for either anion exchanger 1 (AE1), which is expressed on the basolateral border of A-ICs (A, thin arrow) or (P)RR (B). (P)RR was most abundant at the luminal surface of A-ICs (thick arrow). (Each original magnification, ×1000.)

Ultrastructural Localization of the (P)RR in ICs

Immunogold electron microscopy was performed to investigate the intracellular distribution of the (P)RR within ICs. Although detectable throughout the cell body of ICs, (P)RR protein was most abundant at the luminal surface (Figure 6A and 6B), with significantly more gold labeling on the luminal portion compared with the luminal portion of neighboring principal cells (3.21±0.35 versus 2.08±0.28 particles per micrometer squared; P<0.05; Figure 6A). Within ICs, gold particles were most abundant within the microvilli when compared with the adjacent cell body (9.26±1.84 versus 3.40±0.58 particles per micrometer squared; P<0.02; Figure 6B and 6C). Intracellularly, the (P)RR was localized within structures reminiscent of the Golgi apparatus (Figure 6D). Minimal gold labeling was seen under control conditions (immunizing peptide–negative control: 0.26±0.10 particles per micrometer squared; no primary antibody–negative control: 0.17±0.06 particles per micrometer squared; Figure 6E and 6F).

Figure 6. Immunogold electron microscopy for (P)RR (arrows) within rat kidney collecting duct ICs. (P)RR protein was more abundant in the ICs than in adjacent principal cells (A) and, although detectable throughout the cell body showed a preponderance in the microvilli (A and B) relative to the cytoplasm (C). Intracellularly, (P)RR protein was notable within the Golgi apparatus (D). Preincubation of the primary antibody with the immunizing peptide (E) and no primary antibody (F) negative controls demonstrated specificity of the immunostaining.

Colocalization of the (P)RR With the Vacuolar H+-ATPase in Collecting Duct ICs

The (P)RR shares sequence homology with the ATP6ap2 accessory subunit of the vacuolar H+-ATPase, which is also found at the luminal surface of A-ICs. We, therefore, next set out to determine whether the (P)RR protein colocalized with the vacuolar H+-ATPase in rat kidneys. Dual-staining immunofluorescence was performed with the vacuolar H+-ATPase protein complex recognized by immunostaining for the B1/2 subunit. Using confocal microscopy and recently generated colocalization algorithms, we found marked colocalization of the (P)RR and the B1/2 subunit of the vacuolar H+-ATPase (Pearson’s coefficient r=0.791±0.035; overlap coefficient r=0.921±0.012; image correlation analysis quotient 0.285±0.014; Figure 7 and Figure S4).

Figure 7. Dual staining immunofluorescence in rat kidney collecting ducts for the (P)RR (A and D, red) and the B1/2 subunit of the vacuolar H+-ATPase (B and E, green) and with images taken from the inner cortex. C and F merged images. (Original magnification, ×63.) D through F are high-power zoom images of a single collecting duct cell from rat kidney.

In Vitro Function of the (P)RR in Cultured MDCK Cells

Having demonstrated abundant expression of the (P)RR in distal nephron structures in vivo, we next sought to examine its functional role in vitro, using cultured collecting duct/distal tubule lineage MDCK cells. Both real-time PCR and Western blot analysis, with the same antibody as used in our immunohistochemical studies, confirmed expression of the (P)RR in MDCK cells (Figure 8A and 8B). Transfection of MDCK cells with siRNA directed against the (P)RR attenuated its expression at both mRNA and protein levels (Figure 8A and 8B).

Figure 8. Role of the (P)RR in cultured MDCK cells. A, Real-time PCR for (P)RR mRNA. B, Immunoblotting for (P)RR protein. C and D, Immunoblotting for phosphorylated ERK 1 and 2 (phospho-ERK1/2) and total ERK 1 and 2, shown as fold change relative to control. Mean of 3 experiments; *P<0.05 vs control, †P<0.001 vs control, ‡P<0.01 vs siRNA, §P<0.05 vs siRNA. AU indicates arbitrary units.

To further investigate the function of the (P)RR in mediating intracellular signaling, we examined the effects of 2 alternative approaches to (P)RR inhibition, siRNA and vacuolar H+-ATPase blockade with bafilomycin. Dose-finding experiments revealed that concentrations as low as 20 pM of either renin or prorenin were sufficient to induce ERK 1/2 phosphorylation in MDCK cells in the presence of angiotensin II type 1 and angiotensin II type 2 receptor blockade (Figure S5). Furthermore, transfection of MDCK cells with (P)RR siRNA significantly attenuated ERK 1/2 phosphorylation, whereas scrambled siRNA was without effect (Figure 8C and 8D). To investigate the functional relationship between the vacuolar H+-ATPase and the (P)RR, MDCK cells were pretreated with bafilomycin. Although bafilomycin alone had no effect on ERK 1/2, it markedly attenuated the increase in phosphorylation induced by either renin or prorenin (Figure 9).

Figure 9. Effect of the vacuolar H+-ATPase inhibitor bafilomycin on renin-(A) and prorenin-(B) stimulated phosphorylation of ERK 1 and 2 in cultured MDCK cells, shown as fold change relative to control. Mean of 3 experiments, *P<0.01 vs either control or bafilomycin, †P<0.05 vs renin, ‡P<0.001 vs either control or bafilomycin, §P<0.05 vs bafilomycin, ∥P<0.01 versus prorenin. AU indicates arbitrary units.

Discussion

Using a combination of in situ hybridization, immunohistochemistry, and electron microscopy, the present report demonstrates that the (P)RR is expressed predominantly by collecting duct intercalated acid–transporting A cells, where it colocalizes with the vacuolar H+-ATPase. Consistent with this locale’s function, in vitro studies show that intracellular signaling through the (P)RR is critically dependent on the activity of the vacuolar H+-ATPase. These findings differ from those in the original report of the (P)RR, which localized it primarily to arteries and the mesangium.2 Nevertheless, the observations reconcile both the uncertainties raised regarding the homology of the (P)RR with other proteins and more recent observations indicating a primarily “tubular” pattern of expression6,7 that was not recognized in the initial description.

In the initial report of its expression cloning, it was noted that the (P)RR shared C-terminal homology with an 8.9-kDa truncated protein, termed M8–9 and now renamed ATP6ap2.2 However, subsequent in silico research revealed that the translated sequences for the (P)RR and ATP6ap2 are not only homologous but are identical (UGID 384092 and UniGene Rn.12944).10,11 By combining in situ hybridization with nephron segment–specific markers, we localized the (P)RR to the distal nephron and the collecting duct. Within this region, the (P)RR was particularly abundant on the luminal surface of collecting duct intercalated A cells in rat kidney, identical to the described localization of the plasmalemmal vacuolar H+-ATPase.15 The discrepancy between the initial description and our findings, as to the site-specific expression of the (P)RR, may in part be attributable to a difference in the primary antibodies used. The commercial antibody that we used was generated using a single immunizing peptide corresponding with the 14 C-terminal amino acids of the (P)RR, whereas that used in the original report was produced by immunizing animals by coinjection of a second peptide in addition to one corresponding with the C-terminal amino acids.2

Vacuolar H+-ATPases are multisubunit complexes that mediate transmembrane energy-dependent H+ transport. While mostly involved in acidification of intracellular compartments, vacuolar H+-ATPases in the kidney are also located on the luminal plasma membrane of some collecting duct cells, where they have a key role in final urinary acidification.15 The gene for the (P)RR/ATP6ap2 component of the vacuolar H+-ATPase is conserved and developmentally critical across a wide range of vertebrate and invertebrate species,28 such that zebrafish that harbor a mutant ATP6ap2 die early in development29 and mouse embryonic stem cells deficient for the (P)RR do not generate chimeras when injected into blastocysts (unpublished observation reported in Reference9). Collectively, these data support an evolutionarily essential role for the (P)RR/ATP6ap2 beyond its possibly more recently acquired (pro)renin binding properties.

In an attempt to reconcile the sequence identity of the (P)RR and ATP6ap2 with their apparently unrelated functions, it has been suggested that the extracellular domain of the protein may undergo cleavage by furin such that only the transmembrane domain associates with the vacuolar H+-ATPase.13,30 However, this hypothesis necessitates the presence of an additional protein, an as-yet-unrecognized (P)RR receptor.13 We were unable to identify a lower molecular weight fragment that might reflect such a transmembrane cleavage product. However, we did note that, intracellularly, the (P)RR appeared to show a predilection for the Golgi apparatus. Intriguingly, both prorenin cleavage to give active renin31 and the hypothesized cleavage of the (P)RR by furin occur in the Golgi.13

Although the mechanism by which either renin or prorenin may induce intracellular signaling remains to be fully elucidated, we did observe an attenuation of ERK 1/2 phosphorylation with the same siRNA as reported previously,3,26 directly implicating the (P)RR in this signaling cascade in MDCK cells. In addition to knockdown of the (P)RR with siRNA, we also sought to test the hypothesis that function of the receptor is related to its association with the vacuolar H+-ATPase. Bafilomycin acts as a vacuolar H+-ATPase inhibitor by binding to the cytoplasmic core27 and has been shown previously to inhibit H+ flux in MDCK cells.32 Intriguingly, preincubation of MDCK cells with bafilomycin markedly attenuated the phosphorylation of mitogen-activated protein kinases ERK 1 and 2 induced by either renin or prorenin.

Although the RAS is classically viewed as a circulatory hormone system, evidence accumulated for >2 decades indicates an important role for a local tissue-based RAS.33 Moreover, even within a single organ, eg, the kidney, the effects of the local RAS may be compartmentalized.34 Indeed, recent data suggest that the collecting duct may be a key site of local RAS activity, where renin, produced in abundance by collecting duct principal cells,35 could ultimately lead to angiotensin II–dependent activation of the collecting duct vacuolar H+-ATPase and modulation of urinary acidification.36,37 The findings in the present study that the (P)RR is also found primarily within collecting duct ICs suggest that the (P)RR may also be a component of a local tissue-based RAS within the collecting system that has a primary role in H+ transport.

Perspectives

In attempting to unravel the complexities of the (P)RR, the present study explicitly demonstrates its colocalization and functional interrelationship with the vacuolar H+-ATPase, the proton pump primarily responsible for final urinary acidification. These studies not only resolve the controversy regarding the site-specific expression of the (P)RR in the kidney but also provide mechanistic insight into its ability to induce p42/44 mitogen-activated protein kinase phosphorylation.

We thank Mariana Pacheco, Jemma Court, Laura DiRago, Sylwia Glowacka, Christine Liao, and Tracey Davey for their excellent technical assistance.

Sources of Funding

This work received support from St. Michael’s Hospital Foundation.

Disclosures

None.

Footnotes

Correspondence to Richard E. Gilbert, Keenan Research Centre of the Li Ka Shing Knowledge Institute, St Michael’s Hospital, 61 Queen St East, Toronto, Ontario, Canada M5C 2T2. E-mail

References

  • 1 Nguyen G, Delarue F, Berrou J, Rondeau E, Sraer JD. Specific receptor binding of renin on human mesangial cells in culture increases plasminogen activator inhibitor-1 antigen. Kidney Int. 1996; 50: 1897–1903.CrossrefMedlineGoogle Scholar
  • 2 Nguyen G, Delarue F, Burckle C, Bouzhir L, Giller T, Sraer JD. Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular responses to renin. J Clin Invest. 2002; 109: 1417–1427.CrossrefMedlineGoogle Scholar
  • 3 Huang Y, Wongamorntham S, Kasting J, McQuillan D, Owens RT, Yu L, Noble NA, Border W. Renin increases mesangial cell transforming growth factor-beta1 and matrix proteins through receptor-mediated, angiotensin II-independent mechanisms. Kidney Int. 2006; 69: 105–113.CrossrefMedlineGoogle Scholar
  • 4 Wilson DM, Luetscher JA. Plasma prorenin activity and complications in children with insulin-dependent diabetes mellitus [see comment]. N Engl J Med. 1990; 323: 1101–1106.CrossrefMedlineGoogle Scholar
  • 5 van den Heuvel M, Batenburg WW, Danser AH. Diabetic complications: A role for the prorenin-(pro)renin receptor-TGF-beta(1) axis? Mol Cell Endocrinol. 2009; 302: 213–218.CrossrefMedlineGoogle Scholar
  • 6 Feldman DL, Jin L, Xuan H, Contrepas A, Zhou Y, Webb RL, Mueller DN, Feldt S, Cumin F, Maniara W, Persohn E, Schuetz H, Jan Danser AH, Nguyen G. Effects of aliskiren on blood pressure, albuminuria, and (pro)renin receptor expression in diabetic TG(mRen-2)27 rats. Hypertension. 2008; 52: 130–136.LinkGoogle Scholar
  • 7 Nguyen G. Increased cyclooxygenase-2, hyperfiltration, glomerulosclerosis, and diabetic nephropathy: put the blame on the (pro)renin receptor? Kidney Int. 2006; 70: 618–620.CrossrefMedlineGoogle Scholar
  • 8 Prieto-Carrasquero MC, Martin VL, Botros F, Navar LG. Prorenin/renin receptor is expressed in the collecting duct of normal rat kidney. FASEB J. 2008; 22: 735.17.Google Scholar
  • 9 Burckle C, Bader M. Prorenin and its ancient receptor. Hypertension. 2006; 48: 549–551.LinkGoogle Scholar
  • 10 Ichihara A, Hayashi M, Kaneshiro Y, Suzuki F, Nakagawa T, Tada Y, Koura Y, Nishiyama A, Okada H, Uddin MN, Nabi AH, Ishida Y, Inagami T, Saruta T. Inhibition of diabetic nephropathy by a decoy peptide corresponding to the “handle” region for nonproteolytic activation of prorenin. J Clin Invest. 2004; 114: 1128–1135.CrossrefMedlineGoogle Scholar
  • 11 Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD, Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T, Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL, Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P, Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH, Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW, Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW, Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U, Smailus DE, Schnerch A, Schein JE, Jones SJ, Marra MA. Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci U S A. 2002; 99: 16899–16903.CrossrefMedlineGoogle Scholar
  • 12 Campbell DJ. Critical review of prorenin and (pro)renin receptor research. Hypertension. 2008; 51: 1259–1264.LinkGoogle Scholar
  • 13 Bader M. The second life of the (pro)renin receptor. J Renin Angiotensin Aldosterone Syst. 2007; 8: 205–208.CrossrefMedlineGoogle Scholar
  • 14 Ludwig J, Kerscher S, Brandt U, Pfeiffer K, Getlawi F, Apps DK, Schagger H. Identification and characterization of a novel 9.2-kDa membrane sector-associated protein of vacuolar proton-ATPase from chromaffin granules. J Biol Chem. 1998; 273: 10939–10947.CrossrefMedlineGoogle Scholar
  • 15 Wagner CA, Finberg KE, Breton S, Marshansky V, Brown D, Geibel JP. Renal vacuolar H+-ATPase. Physiol Rev. 2004; 84: 1263–1314.CrossrefMedlineGoogle Scholar
  • 16 Advani A, Gilbert RE, Thai K, Gow RM, Langham RG, Cox AJ, Connelly KA, Zhang Y, Herzenberg AM, Christensen PK, Pollock CA, Qi W, Tan SM, Parving HH, Kelly DJ. Expression, localization, and function of the thioredoxin system in diabetic nephropathy. J Am Soc Nephrol. 2009; 20: 730–741.CrossrefMedlineGoogle Scholar
  • 17 Advani A, Kelly DJ, Advani SL, Cox AJ, Thai K, Zhang Y, White KE, Gow RM, Marshall SM, Steer BM, Marsden PA, Rakoczy PE, Gilbert RE. Role of VEGF in maintaining renal structure and function under normotensive and hypertensive conditions. Proc Natl Acad Sci U S A. 2007; 104: 14448–14453.CrossrefMedlineGoogle Scholar
  • 18 Tajika Y, Matsuzaki T, Suzuki T, Aoki T, Hagiwara H, Tanaka S, Kominami E, Takata K. Immunohistochemical characterization of the intracellular pool of water channel aquaporin-2 in the rat kidney. Anat Sci Int. 2002; 77: 189–195.CrossrefMedlineGoogle Scholar
  • 19 Ellison DH. The thiazide-sensitive na-cl cotransporter and human disease: reemergence of an old player. J Am Soc Nephrol. 2003; 14: 538–540.CrossrefMedlineGoogle Scholar
  • 20 Toubeau G, Nonclercq D, Zanen J, Lambricht P, Tulkens PM, Heuson-Stiennon JA, Laurent G. Distribution of epidermal growth factor in the kidneys of rats exposed to amikacin. Kidney Int. 1991; 40: 691–699.CrossrefMedlineGoogle Scholar
  • 21 Salido EC, Lakshmanan J, Fisher DA, Shapiro LJ, Barajas L. Expression of epidermal growth factor in the rat kidney: an immunocytochemical and in situ hybridization study. Histochemistry. 1991; 96: 65–72.CrossrefMedlineGoogle Scholar
  • 22 Alper SL, Natale J, Gluck S, Lodish HF, Brown D. Subtypes of intercalated cells in rat kidney collecting duct defined by antibodies against erythroid band 3 and renal vacuolar H+-ATPase. Proc Natl Acad Sci U S A. 1989; 86: 5429–5433.CrossrefMedlineGoogle Scholar
  • 23 Wazen RM, Tye CE, Goldberg HA, Hunter GK, Smith CE, Nanci A. In vivo functional analysis of polyglutamic acid domains in recombinant bone sialoprotein. J Histochem Cytochem. 2007; 55: 35–42.CrossrefMedlineGoogle Scholar
  • 24 Bolte S, Cordelieres FP. A guided tour into subcellular colocalization analysis in light microscopy. J Microsc. 2006; 224: 213–232.CrossrefMedlineGoogle Scholar
  • 25 Feldt S, Batenburg WW, Mazak I, Maschke U, Wellner M, Kvakan H, Dechend R, Fiebeler A, Burckle C, Contrepas A, Jan Danser AH, Bader M, Nguyen G, Luft FC, Muller DN. Prorenin and renin-induced extracellular signal-regulated kinase 1/2 activation in monocytes is not blocked by aliskiren or the handle-region peptide. Hypertension. 2008; 51: 682–688.LinkGoogle Scholar
  • 26 Huang Y, Noble NA, Zhang J, Xu C, Border WA. Renin-stimulated TGF-beta1 expression is regulated by a mitogen-activated protein kinase in mesangial cells. Kidney Int. 2007; 72: 45–52.CrossrefMedlineGoogle Scholar
  • 27 Huss M, Wieczorek H. Inhibitors of V-ATPases: old and new players. J Exp Biol. 2009; 212: 341–346.CrossrefMedlineGoogle Scholar
  • 28 L'Huillier NL, Sharp MGF, Dunbar DR, Mullins JJ. On the relationship between the renin receptor and the vacuolar proton-ATPase membrane sector associated protein (M8-9). In: Frohlich ED, Re RN, eds. The Local Cardiac Renin Angiotensin-Aldosterone System. New York, NY: Springer; 2006: 17–34.Google Scholar
  • 29 Amsterdam A, Nissen RM, Sun Z, Swindell EC, Farrington S, Hopkins N. Identification of 315 genes essential for early zebrafish development. Proc Natl Acad Sci U S A. 2004; 101: 12792–12797.CrossrefMedlineGoogle Scholar
  • 30 Batenburg WW, Jan Danser AH. The (pro)renin receptor: a new addition to the renin-angiotensin system? Eur J Pharmacol. 2008; 585: 320–324.CrossrefMedlineGoogle Scholar
  • 31 Pratt RE, Ouellette AJ, Dzau VJ. Biosynthesis of renin: multiplicity of active and intermediate forms. Proc Natl Acad Sci U S A. 1983; 80: 6809–6813.CrossrefMedlineGoogle Scholar
  • 32 Feifel E, Krall M, Geibel JP, Pfaller W. Differential activities of H+ extrusion systems in MDCK cells due to extracellular osmolality and pH. Am J Physiol. 1997; 273: F499–F506.MedlineGoogle Scholar
  • 33 Kobori H, Nangaku M, Navar LG, Nishiyama A. The intrarenal renin-angiotensin system: from physiology to the pathobiology of hypertension and kidney disease. Pharmacol Rev. 2007; 59: 251–287.CrossrefMedlineGoogle Scholar
  • 34 Gilbert RE, Wu LL, Kelly DJ, Cox A, Wilkinson-Berka JL, Johnston CI, Cooper ME. Pathological expression of renin and angiotensin II in the renal tubule after subtotal nephrectomy: implications for the pathogenesis of tubulointerstitial fibrosis. Am J Pathol. 1999; 155: 429–440.CrossrefMedlineGoogle Scholar
  • 35 Prieto-Carrasquero MC, Botros FT, Pagan J, Kobori H, Seth DM, Casarini DE, Navar LG. Collecting duct renin is upregulated in both kidneys of 2-kidney, 1-clip goldblatt hypertensive rats. Hypertension. 2008; 51: 1590–1596.LinkGoogle Scholar
  • 36 Rothenberger F, Velic A, Stehberger PA, Kovacikova J, Wagner CA. Angiotensin II stimulates vacuolar H+-ATPase activity in renal acid-secretory intercalated cells from the outer medullary collecting duct. J Am Soc Nephrol. 2007; 18: 2085–2093.CrossrefMedlineGoogle Scholar
  • 37 Pech V, Zheng W, Pham TD, Verlander JW, Wall SM. Angiotensin II activates H+-ATPase in type A intercalated cells. J Am Soc Nephrol. 2008; 19: 84–91.CrossrefMedlineGoogle Scholar

eLetters(0)

eLetters should relate to an article recently published in the journal and are not a forum for providing unpublished data. Comments are reviewed for appropriate use of tone and language. Comments are not peer-reviewed. Acceptable comments are posted to the journal website only. Comments are not published in an issue and are not indexed in PubMed. Comments should be no longer than 500 words and will only be posted online. References are limited to 10. Authors of the article cited in the comment will be invited to reply, as appropriate.

Comments and feedback on AHA/ASA Scientific Statements and Guidelines should be directed to the AHA/ASA Manuscript Oversight Committee via its Correspondence page.