Skip main navigation

Renoprotective Effects of Small Interfering RNA Targeting Liver Angiotensinogen in Experimental Chronic Kidney Disease

Originally publishedhttps://doi.org/10.1161/HYPERTENSIONAHA.120.16876Hypertension. 2021;77:1600–1612

Abstract

Small interfering RNA (siRNA) targeting liver angiotensinogen (AGT) lowers blood pressure, but its effectiveness in hypertensive chronic kidney disease is unknown. Considering that the kidney may generate its own AGT, we assessed the effectiveness of liver-targeted AGT siRNA in the 5/6th Nx (5/6th nephrectomy) rat—a hypertensive chronic kidney disease model. Five weeks after 5/6th Nx (baseline), rats were subjected to vehicle, AGT siRNA, AGT siRNA+losartan, losartan, or losartan+captopril. Baseline mean arterial pressure was 160±6 mm Hg. Over the course of 4 weeks, mean arterial pressure increased further by ≈15 mm Hg during vehicle treatment. This rise was prevented by AGT siRNA. Losartan reduced mean arterial pressure by 37±6 mm Hg and increased plasma Ang (angiotensin) II. Both AGT siRNA and captopril suppressed these effects of losartan, suggesting that its blood pressure–lowering effect relied on stimulation of vasodilator Ang II type 2 receptors by high Ang II levels. Proteinuria and cardiac hypertrophy increased with vehicle, and these increases were comparably abrogated by all treatments. No intervention improved glomerular filtration rate, while siRNA and losartan equally diminished glomerulosclerosis. AGT siRNA±losartan reduced plasma AGT by >95%, and this was accompanied by almost complete elimination of Ang II in kidney and heart, without decreasing renal AGT mRNA. Multiple linear regression confirmed both mean arterial pressure and renal Ang II as independent determinants of proteinuria. In conclusion, AGT siRNA exerts renoprotection in the 5/6th Nx model in a blood pressure–independent manner. This relies on the suppression of renal Ang II formation from liver-derived AGT. Consequently, AGT siRNA may prove beneficial in human chronic kidney disease.

Introduction

Treatment of chronic kidney disease (CKD) often involves the use of renin-angiotensin system (RAS) blockers to treat hypertension and confer renoprotection. The latter is believed to be due to interference with either the generation or effects of Ang (angiotensin) II at renal tissue sites. Here, it has often been argued that apart from renin synthesis in the kidney, angiotensinogen (AGT) is also synthesized at renal tissue sites, for instance in the proximal tubule.1 Given the broad expression of ACE (angiotensin-converting enzyme) in the kidney,2 this implies that all components required to synthesize Ang II are present in the kidney,3 thereby allowing locally synthesized Ang II to exert its effects fully independently from circulating Ang II, that is, by stimulating AT1 (Ang II type 1 receptor) and AT2 (Ang II type 2 receptor) at renal tissue sites.

RAS blockade is hampered by counterbalancing mechanisms, the most important of which is renin upregulation.4 As a consequence, the degree of RAS suppression may be less than anticipated, even more so if organs express their own AGT. Furthermore, particularly during AT1 receptor blocker (ARB) treatment, the elevated Ang II levels might stimulate vasodilator AT2 receptors, thereby lowering blood pressure.5

A novel approach of interfering with the RAS is the use of small interfering RNAs (siRNAs) targeting AGT.6 Currently, siRNA designs exist with hepatocyte-directed, N-acetylgalactosamine–conjugated molecules, which allow stable suppression of hepatic proteins like proprotein convertase subtilisin/kexin type 9, requiring only biannual dosing in humans.7 Given the hepatic origin of circulating AGT, this approach could allow a similar suppression of AGT. Importantly, under such circumstances, counterbalancing renin rises should no longer be able to restore Ang II in blood, simply because AGT is lacking. Indeed, a N-acetylgalactosamine–conjugated siRNA targeting AGT was highly effective in suppressing circulating AGT in SHRs (spontaneously hypertensive rats),6 thereby reducing blood pressure to the same degree as ACE inhibitors and ARBs. Moreover, combining this AGT siRNA with an ARB virtually eliminated Ang II because the accompanying further renin rise now cleaved any remaining AGT and thus exhausted the source of Ang peptides.

A remaining question is to what degree this approach also exerts beneficial effects at tissue sites, in particular in the kidney, given its own AGT synthesis. Here, it should be noted that RAS blockade has a limit and that too much RAS blockade (eg, by combining multiple RAS blockers at the same time) may result in hypotension, acute kidney injury, and hyperkalemia. Disappointingly, a 2-week treatment of the 5/6th Nx (5/6th nephrectomy) rat—a CKD model that is responsive to the RAS blockade8–10—with AGT antisense oligonucleotides (liver specific or nonspecific) revealed no beneficial effect on proteinuria or renal histology.11 Nonspecific AGT suppression even impaired renal function (evidenced by a reduced creatinine clearance) and worsened histology, while hepatic-specific suppression was indistinguishable from vehicle treatment. Based on this, the authors argued that nonspecific AGT suppression is potentially deleterious because it lowers renal Ang II too much. Yet, they did not report renal Ang levels. Moreover, their results were obtained while exposing the 5/6th Nx rats to a low-salt diet (0.015% NaCl). Since this will greatly upregulate the dependency of renal function on the RAS, it may explain why no beneficial effects of AGT suppression were observed.

Therefore, in the present study, we set out to investigate the effects of liver-targeted AGT siRNA in the same CKD model (the 5/6th Nx rat) under normal salt conditions, applying treatment for a longer time period (4 weeks) and making a comparison versus the ARB losartan or dual RAS blockade (AGT siRNA+losartan or captopril+losartan). Our hypothesis was, firstly, that AGT siRNA alone would exert renoprotection to the same degree as maximal RAS blockade and, secondly, that this would rely on both blood pressure lowering and suppression of renal Ang II. Here, it is important to note that the 5/6th Nx procedure results in significant blood pressure elevation when using a 2-step approach (removal of the right kidney, followed by subsequent removal of 2/3 of the remaining kidney 7–10 days later)8,12 or when combining right uninephrectomy with immediate infarction of 2/3 of the left kidney.9,10,13–15 This is not the case when performing right uninephrectomy at the same time as excision of both poles of the left kidney (1-step approach).13–15 In the present study we used the 2-step approach, allowing us to evaluate the contribution of blood pressure to both the development of proteinuria and the deterioration of glomerular filtration rate (GFR) and renal histology. Furthermore, by simultaneously measuring Ang levels in kidney, heart, and blood, we were able to distinguish the contribution of nonhepatic AGT to their synthesis.

Methods

All supporting data are available within the article and in the Data Supplement.

Animal Studies

All animal experiments were approved by the Animal Welfare Committee of the Erasmus MC (protocol number 16-790-06). Male 6-week-old SD (Sprague-Dawley) rats were obtained from Envigo (Huntingdon, United Kingdom) and maintained on a standard sodium diet (containing 0.27% Na+, translating to ≈57 mg Na+/day per rat). 5/6th Nx was performed in a 2-step procedure as described previously.12 Briefly, right uninephrectomy was performed under isoflurane anesthesia, followed by resection of the poles of the left kidney 10 days later. Right uninephrectomy was combined with telemetry device (HD-S10; Data Sciences International, St. Paul) implantation as described previously.16,17 Animals were allowed to recover for 5 weeks, as this period is necessary for the remnant kidney to attain a new steady-state condition.18 Subsequently, animals were treated for 4 weeks with vehicle (15% dimethylsulfoxide/75% polyethylene glycol-400/10% ethanol; n=10), AGT siRNA (10–30 mg/kg fortnightly by subcutaneous injection, n=12; Alnylam Pharmaceuticals, Cambridge, MA), AGT siRNA+losartan (30 mg/kg per day; n=7; Sigma-Aldrich, Zwijndrecht, the Netherlands), losartan (n=8), or losartan+captopril (6 mg/kg per day; n=8; Sigma-Aldrich). Losartan and captopril doses were chosen on the basis of maximum effectiveness.16,19 The siRNA consisted of a chemically modified antisense strand with sequence UUGAUUUUUGCCCAGGAUAGCUC, hybridized with a chemically modified sense strand of sequence GCUAUCCUGGGCAAAAAUCAA. Oligonucleotides were synthesized as described previously.6 To ensure selective and efficient delivery to hepatocytes, a triantennary N-acetylgalactosamine—a high-affinity ligand for the hepatocyte-specific asialoglycoprotein receptor—was attached to the 3′ end of the sense strand.20 Two doses of AGT siRNA were tested (10 and 30 mg/kg), but since the degree of AGT depletion was identical with both doses (97.3±1.4% versus 95.9±1.1%; Figure S1 in the Data Supplement), data for both doses were combined. Losartan and captopril were administered subcutaneously by osmotic minipump (model 2ML4; Alzet, Cupertino, CA). Four additional 5/6th Nx animals were euthanized after the recovery period, to establish plasma hormone levels, proteinuria, renal histology, and cardiac hypertrophy before the start of treatment (baseline). Eight SD rats (18 weeks old; weight, 407±24 g) were euthanized to establish renal histology in healthy controls. Animals were allocated to treatment groups by stratification based on the 3-day average of mean arterial pressure (MAP) and the GFR measured at baseline. For biochemical measurements, we collected 24-hour urine in metabolic cages and blood plasma by venipuncture from the lateral tail vein before treatment (baseline), after 2 weeks and after 4 weeks of treatment. Blood pressure, heart rate, and animal activity were recorded continuously via radiotelemetry. At the end of the treatment period, rats were anaesthetized by inhalation of isoflurane and exsanguinated: 1 mL blood was collected in 10 mL of 4 mol/L guanidine thiocyanate21 (Sigma-Aldrich) and used for quantification of Ang metabolites; remaining blood was supplemented with EDTA and centrifuged at 16 000g to obtain plasma. Kidneys and heart were harvested, weighed, divided into transverse segments, and fixated in 4% paraformaldehyde for histological analysis or snap-frozen in liquid nitrogen for gene and protein expression analysis. Mesenteric arteries were isolated and used directly in myograph studies.

Biochemical Measurements

In plasma, AGT was measured by enzyme kinetic assay as the maximum quantity of Ang I generated during incubation, at pH 7.4 and 37 °C, with rat kidney renin in the presence of a mixture of ACE, angiotensinase, and serine protease inhibitors.22 The lower limit of detection of this assay was 0.2 nmol/L. In renal tissue, AGT was quantified by Western blotting and normalized versus GAPDH as described before.23 Plasma renin concentration (PRC) was measured by quantifying Ang I generation in the presence of excess porcine AGT (detection limit, 0.17 ng Ang I/mL per hour).24 Ang I was measured by radioimmunoassay. In the cases that measurements were at or below the detection limit, this limit was applied to allow for statistical analysis. Ang metabolites in plasma, kidney, and heart tissue (left ventricle) were measured by liquid chromatography with tandem mass spectrometry analysis as described before.25 Briefly, tissue samples were homogenized under liquid nitrogen and extracted with a guanidinium-based extraction buffer. Stabilized whole blood and tissue extracts were spiked with stable isotope-labeled internal standards for each individual target analyte (Sigma-Aldrich) before being subjected to C18-based solid phase extraction and subsequent liquid chromatography with tandem mass spectrometry analysis. Table S1 specifies the lower limit of quantification for each metabolite. Plasma NT-proBNP (N-terminal pro-B-type natriuretic peptide) was measured with a rat NT-proBNP ELISA kit (detection limit, 15.6 pg/mL; Aviva Systems Biology, San Diego). Urine total protein was measured by the clinical chemistry laboratory of the Erasmus MC. Urinary NGAL (neutrophil gelatinase-associated lipocalin) was measured with a rat NGAL ELISA kit (detection limit, 0.1 pg/mL; Abcam, Cambridge, United Kingdom).

Quantitative Polymerase Chain Reaction

Total RNA was isolated from snap-frozen kidney using the TRI Reagent (Sigma-Aldrich) and reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Venlo, the Netherlands). cDNA was amplified in triplicate in 40 cycles (denaturation at 95 °C for 3 min, thermal cycling at 95 °C for 3 s, annealing/extension at 60 °C for 20 s) followed by a melt curve with a CFX384 (Bio-Rad, Veenendaal, the Netherlands) using Kapa SYBR Fast (Kapa Biosystems). Intron-spanning oligonucleotide primers were designed with NCBI Primer-BLAST for AGT (forward, CCAGCACGACTTCCTGACT; reverse, GCAGGTTGTAGGATCCCCGA), renin (forward, TGTGGTAACTGTGGGTGGAAT; reverse, GCATGAAGGGTATCAGGGGC), and B2M (β2-microglobulin; forward, ATGGCTCGCTCGGTGACCG; reverse, TGGGGAGTTTTCTGAATGGCAAGCA). The ΔΔCt method was used for relative quantification of mRNA expression levels, using the housekeeping gene B2M for normalization.

Kidney Function

GFR was determined at baseline and at the end of treatment, by transcutaneous measurement of fluorescein isothiocyanate–labeled sinistrin (Mannheim Pharma & Diagnostics GmbH, Mannheim, Germany), administered as a bolus injection (0.24 mg/kg dissolved in saline) via the tail vein. A noninvasive clearance–kidney fluorescent detection device together with partner software (Mannheim Pharma & Diagnostics GmbH) was used to generate the elimination kinetics curve of fluorescein isothiocyanate–sinistrin. GFR was derived from the excretion half-life (t1/2) of fluorescein isothiocyanate–sinistrin, using a conversion factor and formula validated for rats26:

GFR (mL/min per 100 g body weight)=31.26 (mL/100 g body weight)/t1/2 fluorescein isothiocyanate–sinistrin (minutes).

Histology

Kidney segments, fixed in 4% paraformaldehyde, were dehydrated and paraffin embedded. Transversely sliced and deparaffinized kidney sections (2 mm) were stained with periodic acid–Schiff and scored semiquantitatively in a blinded fashion by a renal pathologist (M.C.C.-v.G.) as described previously.27 Focal segmental glomerulosclerosis was assessed and graded in all glomeruli of 1 kidney section per rat, basing on an arbitrary scale wherein 0%, <25%, 25% to 50%, 50% to 75%, and >75% of glomerular sclerosis were represented by grade zero (n0), 1 (n1), 2 (n2), 3 (n3), and 4 (n4), respectively. The glomerulosclerosis index was calculated with the formula . Tubular atrophy, interstitial fibrosis, and tubulointerstitial inflammation were scored in the same kidney section and summed to obtain the tubulointerstitial score. A score of 0 to 3 indicated that <25% of tubulointerstitial tissue was affected, a score of 4 to 6 indicated 25% to 50%, and a score of 7 to 9 indicated >50%. Finally, observing dilated tubules and acute thrombotic microangiopathy was used as an indication of hypertensive kidney injury.

Myograph Studies

Mesenteric arteries were carefully dissected and placed in a cold, Krebs bicarbonate solution (composed as follows [in mmol/L]: NaCl, 118; KCl, 4.7; CaCl2, 2.5; MgSO4, 1.2; KH2PO4, 1.2; NaHCO3, 25 and glucose, 8.3; pH=7.4), aerated with 5% CO2 in O2 (carbogen). Arteries were cut into 2-mm segments and mounted in Mulvany myographs (Danish Myo Technology, Aarhus, Denmark) with 6-mL organ baths containing oxygenated Krebs buffer and maintained at 37 °C. Changes in tissue tension were measured using a LabChart data acquisition system (AD Instruments, Ltd, Oxford, United Kingdom). After equilibration for at least 30 minutes and a wash, the vessel segments were stretched to a tension normalized to 90% of 100 mm Hg. After reaching equilibrium, the contractile capacity of the mesenteric arteries was examined by adding 30 mmol/L KCl. After washout, the tissue was exposed to 100 mmol/L KCl to determine the maximal contraction. Endothelial function was checked by verifying relaxation to 10 mmol/L acetylcholine after preconstriction with the thromboxane A2 analogue U46619 (10 nmol/L) to >70% of the maximal contraction. Next, segments were equilibrated in fresh Krebs buffer for 30 minutes and preincubated for 30 minutes with the NO synthase inhibitor Nω-nitro-L-arginine methyl ester hydrochloride (L-NAME; 100 μmol/L), the small- and intermediate-conductance Ca2+-activated K+-channel inhibitors apamin (100 nmol/L) and TRAM34 (10 µmol/L), the ETA (endothelin type A) receptor antagonist BQ123 (1 µmol/L), or the ETB (endothelin type B) receptor antagonist BQ788 (1 µmol/L). Thereafter, concentration-response curves were constructed to endothelin-1. To construct concentration-response curves to the endothelium-dependent dilator acetylcholine, arteries were preconstricted with U46619. All drugs were obtained from Sigma-Aldrich.

Statistics

Data are expressed as mean values ±SEM in case of normal distribution and median with interquartile range in case of non-normal distribution. Non-normally distributed data were log-transformed before statistical analysis. The minimum number of animals per group was calculated to be 7 (4-week treatment; 5 treatment groups; α=0.05; power, 80%; SD, 10 mm Hg; difference in means, 15 mm Hg). Data were analyzed by 1-way ANOVA and mixed linear models, using treatment and time as fixed effects, if appropriate. If significant, selected post hoc analyses were performed between individual groups by controlling for a false discovery rate of 5%.28 Relaxant response to acetylcholine is expressed as a percentage of the contraction to U46619. Contractile responses to endothelin-1 are expressed as a percentage of the contraction to 100 mmol/L KCl. Concentration-response curves were analyzed as described before29 to obtain pEC50 (−10logEC50) and Emax values. Data obtained at multiple points in time were analyzed using a repeated-measures 2-way ANOVA, followed by post hoc correction according to Dunnett or Dunn in case of multiple comparisons, if appropriate. Univariate linear associations were assessed by calculation of Pearson coefficient of correlation. Two-tailed P<0.05 was considered statistically significant. Multiple linear regression analysis was performed to identify variables correlating independently with proteinuria. All analyses were performed using Prism, version 9.0.0 (GraphPad Software, Inc, La Jolla).

Results

AGT siRNA Halts the Blood Pressure Rise in the 5/6th Nx Model

We have reported earlier that MAP in healthy SD rats is 103±1 mm Hg (n=7).23 At 5 weeks after 5/6th Nx (baseline), MAP had increased to 160±6 mm Hg (n=47; Figure 1A). Systolic blood pressure (SBP) and diastolic blood pressure were 187±6 and 126±8 mm Hg, respectively. MAP increased further to 174±5 mm Hg during the subsequent 4 weeks of vehicle treatment. AGT siRNA treatment prevented this increase (P<0.05 versus vehicle; Figure 1A and 1B). Losartan lowered MAP by 37±6 mm Hg (P<0.001 versus vehicle). Adding either AGT siRNA or captopril on top of losartan diminished (P<0.05 versus losartan) the effect of losartan, yielding MAP decreases of 22±7 and 21±6 mm Hg, respectively (both P<0.001 versus vehicle). As a consequence, MAP was identical during treatment with AGT siRNA alone, AGT siRNA+losartan, and losartan+captopril, while it was lower in the losartan-alone group versus the AGT siRNA–alone group (P<0.05). No treatment affected heart rate (Figure 1C), activity (Figure 1D), body weight, or food intake (Table S2). Evaluating the drug effects on the basis of analyses with SBP instead of MAP yielded the same outcome (Figure S2). Figure S2 additionally provides scatter plots of SBP, diastolic blood pressure, and pulse pressure in the various groups at the end of the 4-week treatment.

Figure 1.

Figure 1. Effects on hemodynamics and activity. Mean arterial pressure (MAP; A), ΔMAP (B), heart rate (bpm; C), and locomotor activity (D) in Sprague-Dawley rats subjected to 5/6th nephrectomy and treated with either vehicle, angiotensinogen (AGT) small interfering RNA (siRNA), AGT siRNA+losartan, losartan, or losartan+captopril for 28 d. Treatment was started after 5 wk of recovery. Data are mean±SEM of n=7 to 12. *P<0.05, ***P<0.001 vs vehicle; #P<0.05, &P<0.01, %P<0.001 vs indicated group.

AGT siRNA Suppresses the Circulating RAS

PRC in healthy SD rats amounted to 11.8±0.8 ng Ang I/mL per hour.23 At 5 weeks after 5/6th Nx, PRC had decreased to 2.6 (range, 0.8–3.9) ng Ang I/mL per hour (Figure 2A). All treatments modestly increased PRC, although significance (P<0.05 versus baseline) was reached for losartan only (at 2 weeks). PRC correlated negatively with MAP (P=0.008; Figure 2B) and SBP (P=0.006; Figure S3A). As expected, AGT siRNA, either alone or with losartan, diminished plasma AGT by >95% (Figure 2C). No other treatment affected circulating AGT. Losartan increased plasma Ang I (P<0.001 versus vehicle) and Ang II (P<0.01; Figure 2D and 2E), while in combination with captopril only, plasma Ang I increased (P<0.001). AGT siRNA reduced plasma Ang I (P=0.07) and Ang II (P<0.05) in parallel, with the plasma Ang I levels becoming undetectable in most animals. Combining AGT siRNA with losartan yielded virtually identical Ang I and II levels as AGT siRNA alone. Only captopril reduced the Ang II/I ratio (Table S1). Neither Ang-(1–7), nor Ang III or Ang IV were detectable in blood of 5/6th Nx rats (Table S1), and only after losartan (with or without captopril) did these metabolites become detectable.

Figure 2.

Figure 2. Effects on the circulating renin-angiotensin system. Renin (A), angiotensinogen (AGT; C), Ang (angiotensin) I (D), and Ang II (E) in blood plasma of Sprague-Dawley rats subjected to 5/6th nephrectomy and treated with either vehicle, AGT small interfering RNA (siRNA), AGT siRNA+losartan, losartan, or losartan+captopril for 28 d. Treatment was started after 5 wk of recovery (=baseline). Data are mean±SEM of n=7 to 12. B, The relationship between plasma renin and mean arterial pressure (MAP) during the last 3 treatment days. LLOQ indicates lower limit of quantification. *P<0.05, **P<0.01, ***P<0.001, ***P<0.001 vs indicated group.

AGT siRNA and the Renal RAS

AGT siRNA, as well as the other treatments, tended to upregulate renal renin expression (Figure 3A), but no significance was reached. Renal renin expression correlated closely (P<0.001) with PRC (Figure 3B). AGT siRNA did not affect renal AGT expression (Figure 3C), in agreement with its liver specificity, nor did any of the other treatments affect this expression. Yet, AGT siRNA greatly suppressed the renal AGT, Ang I, and Ang II levels (Figure 3D through 3F), while in combination with losartan, renal Ang I and II were virtually eliminated (P<0.0001 versus AGT siRNA alone). Losartan, with or without captopril, did not affect renal Ang I. Losartan when given alone, modestly reduced renal Ang II (P<0.05 versus vehicle), while in combination with captopril, it reduced renal Ang II more strongly (P<0.01). As a consequence, the renal Ang II/I ratio decreased during both losartan alone and losartan+captopril (P<0.001 versus vehicle; Table S1) but not during the other treatments. Renal Ang III and IV levels were low in the 5/6th Nx model and rapidly became undetectable after most treatments (Table S1). In contrast, renal Ang-(1–7) levels were of identical magnitude as the renal Ang II levels and decreased in parallel with Ang I and II after siRNA (with or without losartan) but not after losartan alone or losartan+captopril.

Figure 3.

Figure 3. Effects on the renal renin-angiotensin system. Renin expression (normalized versus β2-microglobulin; A), angiotensinogen (AGT) mRNA (normalized versus β2-microglobulin; C), AGT protein (fold induction versus GAPDH; D), Ang (angiotensin) I (E), and Ang II (F) in kidneys of Sprague-Dawley rats subjected to 5/6th nephrectomy and treated with either vehicle, AGT small interfering RNA (siRNA), AGT siRNA+losartan, losartan, or losartan+captopril for 28 d. Treatment was started after 5 wk of recovery. Data are mean±SEM of n=7 to 12. B, The relationship between plasma renin and renal renin expression. D, Representative blots. LLOQ indicates lower limit of quantification; and NS, not significant. *P<0.05, **P<0.01, ***P<0.001, ***P<0.001 vs indicated group.

AGT siRNA Is Renoprotective

GFR in healthy SD rats is 1.0±0.04 mL/min per 100 g of body weight.23 At 5 weeks after the 5/6th Nx procedure, GFR had decreased to 0.38±0.10 mL/min per 100 g of body weight. Neither vehicle nor any treatment affected GFR over the next 4 weeks (Figure 4A). None of the treatments altered water intake (Table S2), urinary volume (Table S2), or urinary NGAL excretion (Figure 4B), although losartan, with or without AGT siRNA, did tend to reduce the latter (P=NS). Proteinuria (13 [range, 8.5–16] mg/day) in healthy SD rats (n=73, unpublished results) was 140 (range, 92–170) mg/day at 5 weeks after 5/6th Nx. It rapidly increased further during vehicle treatment, and all treatments, whether given alone or in combination, fully prevented this rise (Figure 4C). Proteinuria correlated significantly with MAP (P<0.001; Figure 4D), SBP (P<0.0001; Figure S3B), and renal Ang II (P=0.03; Figure 4E). Incorporating MAP and renal Ang II in a multiple linear regression model confirmed that both MAP (standardized coefficient, 0.69; P<0.0001) and renal Ang II (standardized coefficient, 0.26; P=0.023) were independent determinants of proteinuria (adjusted R2=0.60). Results were identical if replacing MAP by SBP (data not shown).

Figure 4.

Figure 4. Effects on renal function. Glomerular filtration rate (GFR; expressed as change versus baseline; A), urinary NGAL (neutrophil gelatinase-associated lipocalin) excretion (B), and proteinuria (C) in kidneys of Sprague-Dawley rats subjected to 5/6th nephrectomy and treated with either vehicle, angiotensinogen (AGT) small interfering RNA (siRNA), AGT siRNA+losartan, losartan, or losartan+captopril for 28 d. Treatment was started after 5 wk of recovery (=baseline). Data are mean±SEM of n=7 to 12. D and E, The relationship between proteinuria at 4 wk and mean arterial pressure (MAP) during the last 3 treatment days and the renal Ang (angiotensin) II levels, respectively. BW indicates body weight; and NS, not significant. *P<0.05, **P<0.01, ***P<0.001 vs indicated group.

The percentage of glomeruli having any degree of glomerular injury, focal segmental glomerulosclerosis, glomerulosclerosis index, and tubulointerstitial score all increased over the 8-week period after 5/6th Nx (Figure 5), although statistical significance for the latter was not reached (P=0.06). The significant increases in kidney injury scores versus healthy control disappeared after all treatments, except after the treatment with losartan+AGT siRNA. The number of rats with dilated tubules increased from 0/8 in the healthy control group to 2/4 at baseline and 7/10 after 4 weeks of vehicle exposure. Acute thrombotic microangiopathy featured in these groups in 0/8, 2/4, and 5/10 rats, respectively, with arterial involvement in 1/10 of vehicle-treated rats. AGT siRNA, AGT siRNA+losartan, losartan, and losartan+captopril reduced the number of rats with dilated tubules to 5/12, 2/7, 2/8, and 4/8 and acute thrombotic microangiopathy to 4/12, 2/7, 1/8, and 2/8 rats (with arterial involvement in 2/12 AGT siRNA-treated rats and 1/8 losartan+captopril-treated rats), respectively. These data, therefore, fully agree with the histology scores.

Figure 5.

Figure 5. Effects on renal histology. Percentage of glomeruli having any degree of glomerular injury (A), focal segmental glomerulosclerosis (FSGS; B), glomerulosclerosis index (GSI; C), and tubulointerstitial score (TIS; D) in kidneys of Sprague-Dawley rats subjected to 5/6th nephrectomy and treated with either vehicle, angiotensinogen (AGT) small interfering RNA (siRNA), AGT siRNA+losartan, losartan, or losartan+captopril for 28 d. Treatment was started after 5 wk of recovery (=baseline), and data in healthy rats have been added for comparison. Data are mean±SEM of n=7 to 12. E–H, Representative, periodic acid–Schiff-stained renal histological images of different types of damage illustrating a normal kidney (E), thrombotic microangiopathy of glomeruli and arteriole (F), dilated tubules (G), and a thrombus in a main large vessel (H). NS indicates not significant. *P<0.05, **P<0.01, ***P<0.001 vs indicated group.

AGT siRNA Is Cardioprotective

Cardiac Ang I and II levels in vehicle-treated 5/6th Nx rats were close to or below detection limit (Figure 6A and 6B). siRNA, with or without losartan, lowered these levels even further (P<0.05 versus vehicle), while losartan alone and losartan+captopril upregulated cardiac Ang I (P<0.05). Losartan did not alter cardiac Ang II, while losartan+captopril lowered cardiac Ang II (P<0.05). As a consequence, the Ang II/I ratio decreased after both losartan and losartan+captopril (P<0.05; Table S1). All other Ang metabolites were undetectable in cardiac tissue of 5/6th Nx rats, and only after losartan and losartan+captopril did Ang-(1–7) occasionally rise above the lower limit of quantification (P=NS). No treatment lowered NT-proBNP (Figure 6C). Yet, all treatments equally prevented the rise in heart weight/tibia length ratio that occurred over the 4-week period after starting therapy (Figure 6D). The heart weight/tibia length ratio correlated strongly with MAP (P<0.001; Figure 6E) and SBP (P<0.0001; Figure S3C) but not with cardiac Ang II (data not shown).

Figure 6.

Figure 6. Effects on the cardiac renin-angiotensin system and cardiac hypertrophy. Cardiac angiotensin I (A), cardiac angiotensin II (B), plasma NT-proBNP (N-terminal pro-B-type natriuretic peptide; C), and heart weight/tibia length (HW/TL) ratio (D) in Sprague-Dawley rats subjected to 5/6th nephrectomy and treated with either vehicle, angiotensinogen (AGT) small interfering RNA (siRNA), AGT siRNA+losartan, losartan, or losartan+captopril for 28 d. Treatment was started after 5 wk of recovery (=baseline). Data are mean±SEM of n=7 to 12. E, The relationship between cardiac hypertrophy (HW/TL) and mean arterial pressure (MAP) during the last 3 treatment days. LLOQ indicates lower limit of quantification; and NS, not significant. *P<0.05, **P<0.01 vs indicated group.

5/6th Nx Does Not Alter Vascular Function

Acetylcholine fully relaxed U46619-preconstricted mesenteric arteries of 5/6th Nx rats (Figure S4; Table S3). Blocking NO (with L-NAME) or endothelium-derived hyperpolarization (with TRAM34+apamin) marginally prevented this relaxation, and only when combining L-NAME with TRAM34+apamin did the blockade become significant. This indicates that the acetylcholine response depends on both NO and endothelium-derived hyperpolarization and that the two pathways are interchangeable. No treatment altered this outcome. endothelin-1 strongly constricted mesenteric arteries of 5/6th Nx rats, and the ETA receptor antagonist BQ123, but not the ETB receptor antagonist BQ788, blocked this constriction, indicating that it depended entirely on ETA receptor stimulation. No treatment altered this outcome.

Discussion

This study is the first to demonstrate reno- and cardioprotection in the rat 5/6th Nx model after a 4-week treatment with liver-directed AGT siRNA. The model is characterized by hypertension, cardiac hypertrophy, proteinuria, reduced GFR, glomerulosclerosis, and tubulointerstitial fibrosis, and, therefore, recapitulates important characteristics of CKD.30 Although it is known to be responsive to RAS blockade,8–10 we found circulating RAS activity in the 5/6th Nx rat to be greatly reduced, while renin upregulation during RAS blockade was barely detectable. This may simply reflect the fact that 5/6th of the kidneys was removed, reducing the capacity of the kidneys to release renin or to respond appropriately to RAS blockade.31 In contrast, renin rises during RAS blockade (including AGT suppression) in salt-depleted humans,4 and SHRs6 can easily be >100-fold, thereby allowing Ang II levels to stay in the normal range, even when blocking the system by >99%.

We compared the effect of AGT siRNA in the 5/6th Nx model to the ARB losartan or combined treatment with losartan and the ACE inhibitor captopril—2 drugs that are commonly used separately but not together in patients with CKD. Treatment was started at 5 weeks after 5/6th Nx, when blood pressure had already increased by ≈60 mm Hg. Despite the >75% reduction in circulating RAS activity at that time, the Ang II–AT1 receptor axis may still have contributed to this blood pressure rise. Indeed, losartan did lower blood pressure by 37 mm Hg. This was accompanied by renin and Ang II rises. Remarkably, when combining losartan with either AGT siRNA or captopril, its blood pressure–lowering effect was diminished, while AGT siRNA alone did not lower blood pressure, although it did prevent a further rise in blood pressure after the initial 5-week period. As a consequence, after 4 weeks of treatment, MAP was lower in the losartan group than in the AGT siRNA group, while MAP in the losartan+AGT siRNA and losartan+captopril groups was identical to that in the AGT siRNA–alone group (ie, ≈40 mm Hg above that in healthy SD rats23). The most likely explanation for these observations is that losartan, by upregulating Ang II, allowed concomitant AT2 receptor stimulation, which would result in more substantial blood pressure lowering (given that AT2 receptors cause vasodilation32–34) than might be expected from blockade of the Ang II–AT1 receptor axis alone. This is not possible in combination with either siRNA or captopril, since these drugs prevented such a rise in circulating Ang II. Although studies with the AT2 receptor antagonist PD123319 in the 5/6th Nx model confirm this concept,35 the relevance of AT2 receptor signaling in humans is unclear. Despite the difference in blood pressure reduction, losartan, AGT siRNA, and losartan+captopril reduced cardiac hypertrophy, proteinuria, and glomerulosclerosis comparably, and a favorable trend was observed for the tubulointerstitial score and urinary NGAL. These protective effects in kidney and heart, therefore, must reflect the consequence of local RAS blockade. Indeed, AGT siRNA lowered the cardiac and renal Ang I and II levels more strongly than the circulating Ang I and II levels. Taken together, these data illustrate that cardiac and renal Ang generation depend on liver-derived AGT, accumulating at tissue sites either via diffusion or by active uptake mechanisms. Our data do not support the concept11 that renal Ang II production in the 5/6th Nx rat depends on locally produced AGT and that liver-targeting of AGT siRNA would keep renal Ang II formation intact. We stress that AGT mRNA expression did occur in renal tissue of the 5/6th Nx rat. In agreement with the liver specificity of our N-acetylgalactosamine–labeled siRNA, this expression was unaltered after AGT siRNA, nor was it altered by any of the other treatments. Yet, when treating the rats with AGT siRNA+losartan, renal Ang II entirely disappeared. The strong suppression of renal Ang II after AGT siRNA+losartan lowered proteinuria and cardiac hypertrophy to the same degree as single treatment but no longer improved glomerulosclerosis. This observation supports the concept that complete elimination of the renal RAS is undesirable and may underlie the renal side effects of conventional dual and triple RAS blockade.36,37 However, the latter particularly concerns a reduction in GFR, and this was not observed in the present study. In fact, no treatment affected the ≈60% GFR reduction in our model, although GFR improvement has been observed previously in 5/6th Nx rats after RAS blockade.10 This may relate to the larger (>75%) GFR reduction in those earlier studies.

Proteinuria correlated with MAP and the renal Ang II levels. A unifying concept to explain our data is, therefore, that both a decrease in blood pressure and a decrease in renal Ang II improve proteinuria, most likely in an additive manner and involving a reduction in glomerulosclerosis. Multiple linear regression confirmed this view. Hence, losartan predominantly exerts its effects via blood pressure lowering (likely depending on AT2 receptor stimulation), while siRNA rather acts by suppressing renal Ang II. Whether a similar mechanism (blood pressure lowering and suppression of tissue Ang II generation38) underlies the improvement of cardiac hypertrophy remains to be proven. Heart weight/tibia length ratio correlated with MAP only and not with cardiac Ang II, possibly because cardiac Ang II levels after treatment were often below the detection limit. No effect of any treatment on NT-proBNP was observed, possibly because the blood pressure–lowering effects (with the exception of that of losartan alone) were modest, so that atrial stretch (a major stimulant of BNP synthesis) would be reduced only mildly.

Both captopril and losartan suppressed the Ang II/I ratio in the kidney and heart. In the case of captopril, this simply reflects the degree of ACE inhibition. In the case of losartan, like during ACE inhibition, there will be renin upregulation, resulting in enhanced Ang I generation. Ang II generation should increase in parallel. However, tissue Ang II reflects Ang II that has been internalized via AT1 receptors,38,39 and consequently, given the fact that losartan inhibits this process, ARB treatment may indeed lower the tissue Ang II/I ratio, albeit without affecting the Ang II/I ratio in the circulation. Ang-(1–7) has been suggested to be responsible for the beneficial effects of RAS blockade in both kidney and heart, as it counteracts the Ang II–AT1 receptor axis.40 In the present study, Ang-(1–7) was not detectable in either blood or cardiac tissue of 5/6th Nx rats, although it was present in the kidney. Nevertheless, AGT siRNA eliminated renal Ang-(1–7), thereby implying that its beneficial effects are unrelated to this peptide.

Perspectives

In summary, liver-targeted AGT siRNA exerts beneficial renal and cardiac effects in the 2-step 5/6th Nx rat despite the fact that this is a low-renin CKD model. Its tissue effects are likely to represent the maximum effect of RAS blockade, since adding losartan on top of AGT siRNA (or combining losartan with captopril) yielded an identical degree of reno- and cardioprotection. These effects reflect the dependency of both renal and cardiac Ang II on liver-derived AGT. In view of the potential long-lasting effects of siRNA treatment (as with inclisiran, which is dosed every 6 months7), targeting hepatic AGT offers new possibilities for the treatment of CKD in humans, especially in nonadherent patients. Future studies will be needed to understand both the long-term risks and benefits of such long-term tissue RAS suppression, considering that too much renal Ang II suppression may not be desirable.

Nonstandard Abbreviations and Acronyms

5/6th Nx

5/6th nephrectomy

AGT

angiotensinogen

Ang

angiotensin

ARB

angiotensin II type 1 receptor blocker

AT1

angiotensin II type 1 receptor

AT2

angiotensin II type 2 receptor

CKD

chronic kidney disease

ETA

endothelin type A

ETB

endothelin type B

GFR

glomerular filtration rate

L-NAME

Nω-nitro-L-arginine methyl ester hydrochloride

MAP

mean arterial pressure

NGAL

neutrophil gelatinase-associated lipocalin

NT-proBNP

N-terminal pro-B-type natriuretic peptide

PRC

plasma renin concentration

RAS

renin-angiotensin system

SBP

systolic blood pressure

SD

Sprague-Dawley

SHR

spontaneously hypertensive rat

siRNA

small interfering RNA

Disclosures J.B. Kim, I. Zlatev, L. Melton, S. Huang, and D. Foster are employees of Alnylam Pharmaceuticals. A.H.J. Danser received a grant from Alnylam Pharmaceuticals, which has partially supported this work. O. Domenig and M. Poglitsch are employees of Attoquant Diagnostics. The other authors report no conflicts.

Footnotes

*D.M. Bovée and L. Ren contributed equally.

The Data Supplement is available with this article at https://www.ahajournals.org/doi/suppl/10.1161/HYPERTENSIONAHA.120.16876.

For Sources of Funding and Disclosures, see page 1611.

Correspondence to: A.H. Jan Danser, Division of Vascular Medicine and Pharmacology, Department of Internal Medicine, Erasmus MC, Room Ee1418b, Wytemaweg 80, 3015 CN Rotterdam, the Netherlands. Email

References

  • 1. Kobori H, Nangaku M, Navar LG, Nishiyama A. The intrarenal renin-angiotensin system: from physiology to the pathobiology of hypertension and kidney disease.Pharmacol Rev. 2007; 59:251–287. doi: 10.1124/pr.59.3.3CrossrefMedlineGoogle Scholar
  • 2. Metzger R, Bohle RM, Pauls K, Eichner G, Alhenc-Gelas F, Danilov SM, Franke FE. Angiotensin-converting enzyme in non-neoplastic kidney diseases.Kidney Int. 1999; 56:1442–1454. doi: 10.1046/j.1523-1755.1999.00660.xCrossrefMedlineGoogle Scholar
  • 3. van Kats JP, Schalekamp MA, Verdouw PD, Duncker DJ, Danser AH. Intrarenal angiotensin II: interstitial and cellular levels and site of production.Kidney Int. 2001; 60:2311–2317. doi: 10.1046/j.1523-1755.2001.00049.xCrossrefMedlineGoogle Scholar
  • 4. Balcarek J, Sevá Pessôa B, Bryson C, Azizi M, Ménard J, Garrelds IM, McGeehan G, Reeves RA, Griffith SG, Danser AH, et al. Multiple ascending dose study with the new renin inhibitor VTP-27999: nephrocentric consequences of too much renin inhibition.Hypertension. 2014; 63:942–950. doi: 10.1161/HYPERTENSIONAHA.113.02893LinkGoogle Scholar
  • 5. Schalekamp MA, Danser AH. How does the angiotensin II type 1 receptor ‘trump’ the type 2 receptor in blood pressure control?J Hypertens. 2013; 31:705–712. doi: 10.1097/HJH.0b013e32835d6d11CrossrefMedlineGoogle Scholar
  • 6. Uijl E, Mirabito Colafella KM, Sun Y, Ren L, van Veghel R, Garrelds IM, de Vries R, Poglitsch M, Zlatev I, Kim JB, et al. Strong and sustained antihypertensive effect of small interfering RNA targeting liver angiotensinogen.Hypertension. 2019; 73:1249–1257. doi: 10.1161/HYPERTENSIONAHA.119.12703LinkGoogle Scholar
  • 7. Ray KK, Landmesser U, Leiter LA, Kallend D, Dufour R, Karakas M, Hall T, Troquay RP, Turner T, Visseren FL, et al. Inclisiran in patients at high cardiovascular risk with elevated LDL cholesterol.N Engl J Med. 2017; 376:1430–1440. doi: 10.1056/NEJMoa1615758CrossrefMedlineGoogle Scholar
  • 8. Piecha G, Koleganova N, Gross ML, Geldyyev A, Adamczak M, Ritz E. Regression of glomerulosclerosis in subtotally nephrectomized rats: effects of monotherapy with losartan, spironolactone, and their combination.Am J Physiol Renal Physiol. 2008; 295:F137–F144. doi: 10.1152/ajprenal.00065.2008CrossrefMedlineGoogle Scholar
  • 9. Ma LJ, Nakamura S, Aldigier JC, Rossini M, Yang H, Liang X, Nakamura I, Marcantoni C, Fogo AB. Regression of glomerulosclerosis with high-dose angiotensin inhibition is linked to decreased plasminogen activator inhibitor-1.J Am Soc Nephrol. 2005; 16:966–976. doi: 10.1681/ASN.2004060492CrossrefMedlineGoogle Scholar
  • 10. Cao Z, Cooper ME, Wu LL, Cox AJ, Jandeleit-Dahm K, Kelly DJ, Gilbert RE. Blockade of the renin-angiotensin and endothelin systems on progressive renal injury.Hypertension. 2000; 36:561–568. doi: 10.1161/01.hyp.36.4.561LinkGoogle Scholar
  • 11. Mullick AE, Yeh ST, Graham MJ, Engelhardt JA, Prakash TP, Crooke RM. Blood pressure lowering and safety improvements with liver angiotensinogen inhibition in models of hypertension and kidney injury.Hypertension. 2017; 70:566–576. doi: 10.1161/HYPERTENSIONAHA.117.09755LinkGoogle Scholar
  • 12. van Koppen A, Verhaar MC, Bongartz LG, Joles JA. 5/6th nephrectomy in combination with high salt diet and nitric oxide synthase inhibition to induce chronic kidney disease in the Lewis rat.J Vis Exp. 2013;77:e50398.MedlineGoogle Scholar
  • 13. Griffin KA, Picken M, Bidani AK. Method of renal mass reduction is a critical modulator of subsequent hypertension and glomerular injury.J Am Soc Nephrol. 1994; 4:2023–2031.CrossrefMedlineGoogle Scholar
  • 14. Griffin KA, Picken M, Bidani AK. Radiotelemetric BP monitoring, antihypertensives and glomeruloprotection in remnant kidney model.Kidney Int. 1994; 46:1010–1018. doi: 10.1038/ki.1994.361CrossrefMedlineGoogle Scholar
  • 15. Griffin KA, Picken MM, Bakris G, Bidani AK. Relative antihypertensive and glomeruloprotective efficacies of enalapril and candesartan cilexetil in the remnant kidney model.J Renin Angiotensin Aldosterone Syst. 2001; 2(1_suppl):S191–S195. doi: 10.1177/14703203010020013301CrossrefMedlineGoogle Scholar
  • 16. van Esch JH, Moltzer E, van Veghel R, Garrelds IM, Leijten F, Bouhuizen AM, Danser AH. Beneficial cardiac effects of the renin inhibitor aliskiren in spontaneously hypertensive rats.J Hypertens. 2010; 28:2145–2155. doi: 10.1097/HJH.0b013e32833d01aeCrossrefMedlineGoogle Scholar
  • 17. van der Lubbe N, Lim CH, Fenton RA, Meima ME, Jan Danser AH, Zietse R, Hoorn EJ. Angiotensin II induces phosphorylation of the thiazide-sensitive sodium chloride cotransporter independent of aldosterone.Kidney Int. 2011; 79:66–76. doi: 10.1038/ki.2010.290CrossrefMedlineGoogle Scholar
  • 18. Gretz N, Meisinger E, Waldherr R, Strauch M. Acute renal failure after 5/6 nephrectomy: histological and functional changes.Contrib Nephrol. 1988; 60:56–63. doi: 10.1159/000414790CrossrefMedlineGoogle Scholar
  • 19. Zou LX, Imig JD, Hymel A, Navar LG. Renal uptake of circulating angiotensin II in Val5-angiotensin II infused rats is mediated by AT1 receptor.Am J Hypertens. 1998; 11:570–578. doi: 10.1016/s0895-7061(97)00410-xCrossrefMedlineGoogle Scholar
  • 20. Nair JK, Willoughby JL, Chan A, Charisse K, Alam MR, Wang Q, Hoekstra M, Kandasamy P, Kel’in AV, Milstein S, et al. Multivalent N-acetylgalactosamine-conjugated siRNA localizes in hepatocytes and elicits robust RNAi-mediated gene silencing.J Am Chem Soc. 2014; 136:16958–16961. doi: 10.1021/ja505986aCrossrefMedlineGoogle Scholar
  • 21. Campbell DJ, Duncan AM, Kladis A. Angiotensin-converting enzyme inhibition modifies angiotensin but not kinin peptide levels in human atrial tissue.Hypertension. 1999; 34:171–175. doi: 10.1161/01.hyp.34.2.171LinkGoogle Scholar
  • 22. van den Heuvel M, Batenburg WW, Jainandunsing S, Garrelds IM, van Gool JM, Feelders RA, van den Meiracker AH, Danser AH. Urinary renin, but not angiotensinogen or aldosterone, reflects the renal renin-angiotensin-aldosterone system activity and the efficacy of renin-angiotensin-aldosterone system blockade in the kidney.J Hypertens. 2011; 29:2147–2155. doi: 10.1097/HJH.0b013e32834bbcbfCrossrefMedlineGoogle Scholar
  • 23. Uijl E, Ren L, Mirabito Colafella KM, van Veghel R, Garrelds IM, Domenig O, Poglitsch M, Zlatev I, Kim JB, Huang S, et al. No evidence for brain renin-angiotensin system activation during DOCA-salt hypertension.Clin Sci (Lond). 2021; 135:259–274. doi: 10.1042/CS20201239CrossrefMedlineGoogle Scholar
  • 24. de Lannoy LM, Danser AH, van Kats JP, Schoemaker RG, Saxena PR, Schalekamp MA. Renin-angiotensin system components in the interstitial fluid of the isolated perfused rat heart. Local production of angiotensin I.Hypertension. 1997; 29:1240–1251. doi: 10.1161/01.hyp.29.6.1240LinkGoogle Scholar
  • 25. Roksnoer LC, van Veghel R, de Vries R, Garrelds IM, Bhaggoe UM, Friesema EC, Leijten FP, Poglitsch M, Domenig O, Clahsen-van Groningen MC, et al. Optimum AT1 receptor-neprilysin inhibition has superior cardioprotective effects compared with AT1 receptor blockade alone in hypertensive rats.Kidney Int. 2015; 88:109–120. doi: 10.1038/ki.2015.107CrossrefMedlineGoogle Scholar
  • 26. Schock-Kusch D, Sadick M, Henninger N, Kraenzlin B, Claus G, Kloetzer HM, Weiss C, Pill J, Gretz N. Transcutaneous measurement of glomerular filtration rate using FITC-sinistrin in rats.Nephrol Dial Transplant. 2009; 24:2997–3001. doi: 10.1093/ndt/gfp225CrossrefMedlineGoogle Scholar
  • 27. Uijl E, ‘t Hart DC, Roksnoer LCW, Groningen MCC, van Veghel R, Garrelds IM, de Vries R, van der Vlag J, Zietse R, Nijenhuis T, et al. Angiotensin-neprilysin inhibition confers renoprotection in rats with diabetes and hypertension by limiting podocyte injury.J Hypertens. 2020; 38:755–764. doi: 10.1097/HJH.0000000000002326CrossrefMedlineGoogle Scholar
  • 28. Benjamini Y, Krieger AM, Yekutieli J. Adaptive linear step-up procedures that control the false discovery rate.Biometrika. 2006; 93:491–507.CrossrefGoogle Scholar
  • 29. MaassenVanDenBrink A, de Vries R, Saxena PR, Schalekamp MA, Danser AH. Vasoconstriction by in situ formed angiotensin II: role of ACE and chymase.Cardiovasc Res. 1999; 44:407–415. doi: 10.1016/s0008-6363(99)00249-7CrossrefMedlineGoogle Scholar
  • 30. Bovée DM, Cuevas CA, Zietse R, Danser AHJ, Mirabito Colafella KM, Hoorn EJ. Salt-sensitive hypertension in chronic kidney disease: distal tubular mechanisms.Am J Physiol Renal Physiol. 2020; 319:F729–F745. doi: 10.1152/ajprenal.00407.2020CrossrefMedlineGoogle Scholar
  • 31. Pupilli C, Chevalier RL, Carey RM, Gomez RA. Distribution and content of renin and renin mRNA in remnant kidney of adult rat.Am J Physiol. 1992; 263(4 pt 2):F731–F738. doi: 10.1152/ajprenal.1992.263.4.F731CrossrefMedlineGoogle Scholar
  • 32. Kemp BA, Howell NL, Gildea JJ, Keller SR, Padia SH, Carey RM. AT2 receptor activation induces natriuresis and lowers blood pressure.Circ Res. 2014; 115:388–399. doi: 10.1161/CIRCRESAHA.115.304110LinkGoogle Scholar
  • 33. Li XC, Widdop RE. AT2 receptor-mediated vasodilatation is unmasked by AT1 receptor blockade in conscious SHR.Br J Pharmacol. 2004; 142:821–830. doi: 10.1038/sj.bjp.0705838CrossrefMedlineGoogle Scholar
  • 34. Pessôa BS, Slump DE, Ibrahimi K, Grefhorst A, van Veghel R, Garrelds IM, Roks AJ, Kushner SA, Danser AH, van Esch JH. Angiotensin II type 2 receptor- and acetylcholine-mediated relaxation: essential contribution of female sex hormones and chromosomes.Hypertension. 2015; 66:396–402. doi: 10.1161/HYPERTENSIONAHA.115.05303LinkGoogle Scholar
  • 35. Vázquez E, Coronel I, Bautista R, Romo E, Villalón CM, Avila-Casado MC, Soto V, Escalante B. Angiotensin II-dependent induction of AT(2) receptor expression after renal ablation.Am J Physiol Renal Physiol. 2005; 288:F207–F213. doi: 10.1152/ajprenal.00216.2004CrossrefMedlineGoogle Scholar
  • 36. Parving HH, Brenner BM, McMurray JJ, de Zeeuw D, Haffner SM, Solomon SD, Chaturvedi N, Persson F, Desai AS, Nicolaides M, et al; ALTITUDE Investigators. Cardiorenal end points in a trial of aliskiren for type 2 diabetes.N Engl J Med. 2012; 367:2204–2213. doi: 10.1056/NEJMoa1208799CrossrefMedlineGoogle Scholar
  • 37. Danser AH, van den Meiracker AH. Heart failure: new data do not SUPPORT triple RAAS blockade.Nat Rev Nephrol. 2015; 11:260–262. doi: 10.1038/nrneph.2015.30CrossrefMedlineGoogle Scholar
  • 38. Mazzolai L, Pedrazzini T, Nicoud F, Gabbiani G, Brunner HR, Nussberger J. Increased cardiac angiotensin II levels induce right and left ventricular hypertrophy in normotensive mice.Hypertension. 2000; 35:985–991. doi: 10.1161/01.hyp.35.4.985LinkGoogle Scholar
  • 39. van Kats JP, van Meegen JR, Verdouw PD, Duncker DJ, Schalekamp MA, Danser AH. Subcellular localization of angiotensin II in kidney and adrenal.J Hypertens. 2001; 19(3 pt 2):583–589. doi: 10.1097/00004872-200103001-00010CrossrefMedlineGoogle Scholar
  • 40. Santos RAS, Sampaio WO, Alzamora AC, Motta-Santos D, Alenina N, Bader M, Campagnole-Santos MJ. The ACE2/angiotensin-(1-7)/MAS axis of the renin-angiotensin system: focus on angiotensin-(1-7).Physiol Rev. 2018; 98:505–553. doi: 10.1152/physrev.00023.2016CrossrefMedlineGoogle Scholar

Novelty and Significance

What Is New?

  • Small interfering RNA targeting liver angiotensinogen provides cardio- and renoprotection in a blood pressure–independent manner in the 5/6th nephrectomy rat—a hypertensive chronic kidney disease model.

  • Multiple linear regression confirmed both blood pressure and renal angiotensin II as independent determinants of proteinuria.

  • Renal angiotensin II formation in this model depends entirely on angiotensinogen of hepatic origin.

What Is Relevant?

  • Given its stable and sustained efficacy, lasting weeks, RNA interference may prove beneficial in human chronic kidney disease.

Summary

Small interfering RNA targeting liver angiotensinogen abrogated proteinuria, glomerulosclerosis, and cardiac hypertrophy in the 5/6th nephrectomy rat—a hypertensive chronic kidney disease model—to the same degree as the angiotensin II type 1 receptor blocker losartan. Angiotensinogen small interfering RNA reduced plasma angiotensinogen by >95%, and this was accompanied by almost complete elimination of angiotensin II in kidney and heart. Multiple linear regression confirmed both blood pressure and renal angiotensin II as independent determinants of proteinuria. Given its stable and sustained efficacy, lasting weeks, angiotensinogen small interfering RNA may prove beneficial in human chronic kidney disease.

eLetters(0)

eLetters should relate to an article recently published in the journal and are not a forum for providing unpublished data. Comments are reviewed for appropriate use of tone and language. Comments are not peer-reviewed. Acceptable comments are posted to the journal website only. Comments are not published in an issue and are not indexed in PubMed. Comments should be no longer than 500 words and will only be posted online. References are limited to 10. Authors of the article cited in the comment will be invited to reply, as appropriate.

Comments and feedback on AHA/ASA Scientific Statements and Guidelines should be directed to the AHA/ASA Manuscript Oversight Committee via its Correspondence page.