Skip main navigation

Flow Activation of AMP-Activated Protein Kinase in Vascular Endothelium Leads to Krüppel-Like Factor 2 Expression

Originally publishedhttps://doi.org/10.1161/ATVBAHA.109.193540Arteriosclerosis, Thrombosis, and Vascular Biology. 2009;29:1902–1908

Abstract

Objective— Vascular endothelial cells (ECs) confer atheroprotection at locations of the arterial tree where pulsatile laminar flow (PS) exists with a high shear stress and a large net forward direction. We investigated whether the PS-induced expression of the transcription factor Krüppel-Like Factor 2 (KLF2) in cultured ECs and its expression in the mouse aorta is regulated by AMP-activated protein kinase (AMPK).

Methods and Results— AMPK inhibition by Compound C or siRNA had a significant blocking effect on the PS-induced KLF2 expression. The induction of KLF2 by PS led to the increase in eNOS and the suppression of ET-1, which could be reversed by KLF2 siRNA. In addition, PS induced the phosphorylation of ERK5 and MEF2 which are necessary for the KLF2 expression. These mechanotransduction events were abrogated by the blockade of AMPK. Furthermore, the phosphorylation levels of ERK5 and MEF2, as well as the expression of KLF2, were significantly reduced in the aorta of AMPKα2 knockout mice when compared with wild-type control mice.

Conclusion— The flow-mediated AMPK activation is a newly defined KLF2 regulatory pathway in vascular endothelium that acts via ERK5/MEF2.

AMPK mediated the shear-induced phosphorylation of ERK5 and MEF2, which leads to the augmentation of KLF2 and the subsequent regulation of its downstream targets eNOS and ET-1 in cultured endothelial cells and the aortic wall.

Vascular endothelial cells (ECs) in the arterial tree are subjected to shear stress resulting from the flow of blood. ECs exposed to laminar flow patterns are spared from early lesions of atherosclerosis. In contrast, ECs at the arterial bifurcations and curvatures, where disturbed flow patterns exist, are susceptible to the development of atherosclerotic lesions. There is ample evidence indicating that the different patterns of shear stress associated with laminar versus disturbed flows play a significant role in regulating endothelial phenotype and vascular homeostasis.

Krüppel-like factor 2 (KLF2) is a transcription factor whose expression is flow-dependent in vitro and in vivo and has been shown to regulate various EC functions including inflammation, thrombosis, proliferation, and vascular tone.1–3 KLF2 belongs to the family of KLF zinc-finger transcription factors that are important regulators of cell differentiation and development.4 Using microarray analysis, Dekker et al demonstrated that KLF2 is upregulated by prolonged laminar shear stress and that it is expressed in ECs of atherosclerosis-resistant regions of the human aorta.1 Subsequent work by Lingrel and colleagues demonstrated that laminar shear stress induces transcriptional activation of KLF2 in ECs.5 Our previous studies showed that KLF2 was induced by the atheroprotective flow, but not by atheroprone flow.3,6 KLF2 has been implicated in mediating the antiinflammatory effects of flow, presumably by inhibiting proinflammatory transcription factors, such as ATF2,7 AP-1, and NFκB,8 which in turn regulate gene expression.

Functioning as a “fuel gauge” in multiple organ systems, AMPK is also important in the vessel wall. Nagata et al showed that hypoxia activates AMPK in human umbilical vein ECs (HUVECs), as indicated by increased phosphorylation at Thr-172 of the AMPKα subunit.9 The suppression of AMPK signaling by a dominant-negative mutant of AMPK inhibited vascular endothelial growth factor–enhanced EC migration and hypoxia-induced differentiation into tube-like structures.9 Notably, AMPK phosphorylates eNOS at Ser-1177/1179 and thereby augments the eNOS-derived NO bioavailability.10–14 We have previously demonstrated that shear stress regulates AMPK in ECs and that this may account for the NO bioavailability and cell cycle arrested in G0/G1 under steady laminar flow.15,16

Based on the findings that both AMPK and KLF2 are upregulated by atheroprotective flow and both have similar effects on EC biology, we investigate whether AMPK activation is functionally linked to KLF2 expression in the vascular endothelium.

Materials and Methods

Cell Culture and Reagents

HUVECs were isolated from human umbilical cord veins as previously described.17 The cells were cultured on plates coated with collagen I (BD Biosciences) and maintained in medium M199 (Invitrogen) supplemented with 20% fetal bovine serum (Omega), 25% endothelial cell growth medium (Cell Applications), 2 mmol/L L-glutamine, 1 mmol/L sodium pyruvate, and 1% penicillin/streptomycin. Cells within passages 5 to 8 were used in all experiments.

Antibodies used in this study were purchased from the following commercial sources: antiphospho-AMPKα Thr-172, anti-AMPKα, antiphospho-ACC Ser-79, and anti-ACC (Cell Signaling Technology); antiphospho-MEF2 Thr-312 (Abcam), antiphospho-ERK5 Thr-218/Tyr-220 (Millipore), anti–β actin (Sigma): anti–α tubulin (Sigma). The anti-KLF2 antibody was obtained by immunization of the N-terminal region (aa 1 to 245) of human KLF2 fused to Fc. The specificity of antibody was tested by immunoblotting lysates collected from HEK293 cells transfected with cDNAs encoding KLF2, KLF4, KLF6, and KLF13. Immunoreactivity was detected only in cells transfected with KLF2. Compound C was from Calbiochem. The siRNA targeting KLF2 sequence (nucleotides 1482 to 1502 [AATTTGTACTGTCTGCGGCAT] of the cDNA [GenBank Accession No. NM_016270]) was custom synthesized by Ambion. The siRNA targeting AMPK-α1 and AMPK- α2 catalytic-subunits (Hs_PRKAA1_5_HP, Hs_PRKAA2_6 HP Validated siRNA) were purchased from QIAGEN. A negative control siRNA (Silencer Negative Control #1) and a positive control siRNA (Silencer FAM labeled GAPDH siRNA) for monitoring siRNA delivery efficiency were purchased from Ambion.

Flow Experiments

A circulating flow system was used to impose shear stress on HUVECs.18 A reciprocating syringe pump was connected to the circulating system to introduce a sinusoidal component (frequency=1 Hz) onto the shear stress.6 Pulsatile shear flow (PS) was applied to cells with a shear stress of 12±4 dyn/cm2.

RNA Isolation, cDNA Synthesis, and Real-Time PCR

Total RNA was isolated with the use of Trizol reagent (Invitrogen). Reverse transcription was carried out with 3 μg of total RNA by the Superscript II reverse transcriptase (Invitrogen). The synthesized cDNA was used to perform real-time quantitative PCR (qPCR) with the iQ SYBR Green supermix (Bio-Rad, Hercules, CA) on the iCycler real-time PCR detection system (Bio-Rad). The sequences of primer sets were: KLF2, AGACCTACACCAAGAGTTCGCATC and CATGTGCCGTTTCATGTGCAGC; eNOS, TGGTACATGAGCACTGAGATCG and CCACGTTGATTTCCACTGCTG; AMPK, GAATGGAAGGCTGGATGAAA and TTCTGGTGCAGCATAGTTGG; endothelin-1 (ET-1), TCCTCTGCTGGTTCCTGACT and CAGAAACTCCACCCCTGTGT; GAPDH, ATGACATCAAGAAGGTGGTG and CATACCAGGAAATGAGCTTG.

Protein Isolation and Immunoblotting

HUVECs were lysed with RIPA buffer (1% Igepal CA-630, 0.5% sodium deoxycholate, and 0.1% SDS in 1× PBS) containing protease and phosphatase inhibitors. Proteins for in vivo experiments were isolated from the aorta harvested from control (C57BL/6J) or AMPKα2−/− mice. Equal amounts of protein were separated on SDS PAGE and transferred to a nitrocellulose membrane (Bio-Rad). After 1-hour blocking with 5% BSA, the membrane was probed with various primary antibodies and the appropriate secondary antibodies conjugated with horseradish peroxidase (HRP), followed by ECL detection (GE Healthcare). The protein bands were quantified by using the ImageJ software (National Institutes of Health).

siRNA Transfection

HUVECs were transfected with siRNA using the siPORT NeoFX transfection reagent (Ambion). The cells were incubated with the siRNA-transfection reagent complex for 12 hours. Fresh culture media were then added and replaced again at 24 hours. Twenty-four or 48 hours posttransfection, the cells were used in various experiments.

Animal Experiments

All experiments were performed according to institutional protocols (University of California) using 8-week-old male mice. The abdominal aorta was harvested from C57BL6J wild-type mice and AMPKα2−/− mice19 (a gift from Dr B. Viollet, Institute Cochin, University Paris). Aortas were homogenized, and 2 aortic extracts were pooled to yield 1 sample, which was then analyzed for protein expression and phosphorylation by immunoblotting. The experiments were performed on 6 animals, and the pooling of aortic extracts from 2 animals yielded 3 independent biological samples for each measurement.

MEF2 en face immunostaining was performed according to protocols previously published.16 The aortas were isolated and incubated with rabbit antiphospho-MEF2 antibody (Abcam) followed by the Alexa 647-labeled goat anti-rabbit IgG (Invitrogen). Rabbit IgG was used as negative control. The quantitative analysis was performed using LCS Lite software (version 2.0). Four animals were used for en face staining.

Statistical Analysis

All data were analyzed by Student t test (for paired testing between 2 groups used only once) or 2-way ANOVA (for testing of multiple groups). Results are expressed as mean±SD from at least 3 independent experiments. Probability values <0.05 were considered to be statistically significant.

Results

Pulsatile Shear Flow Activates AMPK and Induces KLF2 Expression in ECs

As shown in Figure 1A, PS with a shear stress of 12±4 dyn/cm2 and a frequency of pulsatility at 1 Hz increased the phosphorylation of AMPK Thr172 and its target ACC Ser79 in HUVECs as early as in 5 minutes. The increased phosphorylation of AMPK and ACC peaked at 1 hour and remained elevated for 4 hours (Figure 1A), this elevation lasted for at least 16 hours (data not shown). Parallel to the time course of AMPK activation, PS increased the expression of KLF2 mRNA beginning at 1 hour and the level remained high for at least 24 hours (Figure 1B). The KLF2 protein expression increased at 4 hours after the initiation of PS and remained high at 24 hours (Figure 1C).

Figure 1. PS activates AMPK and induces KLF2 in cultured ECs. Confluent HUVECs were exposed to PS for the indicated times. Static controls are represented as “time 0.” The mean shear stress was 12 dyn/cm2 (represented by dash line) with ±4 dyn/cm2 oscillation at 1 Hz. A and C, ECs were lysed, the lysates were separated by SDS-PAGE, and the membranes were probed with antibodies as indicated. B, RNA samples were isolated, and the levels of KLF2 mRNA were determined and quantified by real-time PCR, with the results normalized by GAPDH. The quantitative graphs below show the ratios of phosphorylated AMPK or ACC to total AMPK or ACC, respectively (A), KLF2 mRNA to GAPDH mRNA (B), and KLF2 to α-tubulin (C) at various time points. The shear results were normalized by that of the corresponding static control. The data represent mean±SD from 3 independent experiments. *P<0.05 between the 2 groups being compared.

AMPK Regulates KLF2 Expression in Response to PS

We next investigated whether AMPK activation is critical for the induction of KLF2 under PS. We inhibited AMPK activity by treating ECs with Compound C (an AMPK antagonist) or by knocking down AMPK expression using siRNA. The levels of KLF2 expression in control and treated cells exposed to PS or maintained under static (no flow) conditions were then assessed. As shown in Figure 2A, Compound C reduced basal expression of KLF2 in static cells and abolished the shear-induction of KLF2 expression at 4 hours. The negative regulation of KLF2 by Compound C was concentration-dependent (supplemental Figure I). Similar to the effect of Compound C, siRNA knockdown of either AMPKα1 or AMPK α2 significantly reduced the 4-hour shear induction of KLF2, with a marginal decrease in the basal expression of KLF2 (Figure 2B and 2C). These results confirmed that AMPK activation is critical for the induction of endothelial KLF2 in response to PS.

Figure 2. AMPK regulates the PS-induced KLF2 and its target genes. HUVECs were treated with Compound C (15 μmol/L) for 30 minutes (A), transfected with AMPKα1 siRNA (B), AMPKα2 siRNA (C), or KLF2 siRNA (D and E) for 48 hours. Control siRNA were used in the parallel experiments. The ECs were then subjected to PS for 4 hours. RNA samples were isolated and the levels of KLF2 (A through C), eNOS (D), and ET-1 (E) mRNA were quantified by real-time qPCR. The results were normalized with GAPDH. The data represent mean±SD from 3 separate experiments. *P<0.05 between the 2 groups being compared.

KLF2 Regulates the eNOS and ET-1 Expression in Response to PS

To delineate the effects of PS-induced KLF2 on its downstream targets, we first determined the optimal siRNA concentration that was able to knockdown KLF2 expression in HUVECs with the efficiency of ≈80% suppression (supplemental Figure II). We next examined the expression of eNOS and ET-1, 2 known targets of KLF2. As seen in Figure 2D, silencing of KLF2 expression led to a reduced level of eNOS in static cells and a significant decrease in eNOS induction in ECs exposed to PS. KLF2 silencing also resulted in the abolishment of PS-suppression of ET-1, which remained at basal level in the presence of PS (Figure 2E). Similar to the EC responses to the steady laminar flow, our results indicate that KLF2 acts as a key transcription factor mediating the PS-dependent expression of eNOS and ET-1, 2 critical genes for the maintenance of vascular homeostasis and vasomotor tone.

AMPK-KLF2 Signaling in Cultured ECs

To further elucidate the mechanism of KLF2 upregulation by AMPK, HUVECs were treated with AICAR (an AMPK agonist) or infected with Ad-AMPK-CA expressing a constitutively active form of AMPK. As shown in Figure 3A, KLF2 expression increased significantly in ECs treated with AICAR and those infected with Ad-AMPK-CA, as indicated by real-time Taqman PCR.

Figure 3. AMPK activates KLF2 via the ERK5-MEF2 pathway in cultured ECs. A, KLF2 and GAPDH transcripts were analyzed by quantitative RT-PCR in HUVECs treated with 1 mmol/L AICAR for 8 hours (left), and with Ad-null or Ad-AMPK-CA for 24 hours (right). B and C, HUVECs were infected with Ad-GFP together with Ad-MEK5-DN or Ad-MEF2-DN followed by AICAR stimulation. Total RNA was extracted and the levels of KLF2 and GAPDH mRNA analyzed by quantitative RT-PCR. The data represent mean±SD from 3 separate experiments.

Because the MEK5/ERK5/MEF2 pathway regulates the flow-induced KLF2, and the phosphorylation of MEF2 at Thr312 by ERK5 increases the rate of MEF2-mediated transcription,3,20 we tested whether AICAR-induction of KLF2 mRNA is mediated by MEK5 and MEF2. As seen in Figure 3B and 3C, the increase in KLF2 in ECs treated with AICAR was abrogated by infection with Ad-MEK5-DN (the dominant negative mutant of the ERK5-upstream kinase MEK) or Ad-MEF2-DN expressing a dominant negative mutant of MEF2.

We then assess the role of AMPK activation in the phosphorylation of MEF2 through the MEK5/ERK5 pathway. The AICAR-induced phosphorylations of AMPK Thr172, ERK5 Thr218, and MEF2 Thr312 were markedly decreased in ECs in which AMPKα1 was knocked down in comparison to those in cells treated with control siRNA (Figure 4A). The knockdown of AMPKα2 also resulted in similar reductions (Figure 4B). Consistent with these results, the AICAR-increased ERK5 phosphorylation was inhibited by Compound C (supplemental Figure IIIA) and AD-MEK5-DN (supplemental Figure IIIB). More importantly, Compound C treatment was able to inhibit the PS flow-increased AMPK activity and ERK5 and MEF2 phosphorylation (Figure 4C). These results established that the activation of KLF2 by AMPK is mediated through ERK5 and MEF2 in cultured ECs and documented a novel interaction between the AMPK and the MAPK signaling pathways.

Figure 4. AMPK upregulates ERK5-MEF2 in ECs. AMPKα1 (A) or AMPKα2 (B) was knocked down by siRNA as described in Figure 2. The cells were then treated with 1 mmol/L AICAR or vehicle control for 1 hour and lysed for Western blotting with antip-AMPK(Thr172), antip-ERK5(Thr218), and p-MEF2(Thr312). The bar graphs are the statistical analysis of the ratio of p-ERK5 or p-MEF2 to that of total ERK5 and MEF2, respectively. C, HUVECs were treated with Compound C (15 μmol/L) for 30 minutes and then subjected to PS flow for 0.5 and 1.5 hours, followed by Western blotting with anti–p-ACC(Ser79), anti–p-ERK5(Thr218), and p-MEF2(Thr312). The data represent mean±SD from 3 separate experiments. *P<0.05 between the 2 groups being compared.

AMPK-KLF2 Signaling In Vivo

To examine the role of the AMPK-KLF2 pathway in vivo, KLF2 expression was studied in AMPK knockout mice. AMPK α2 seems to play a more important role than AMPK α1 in fuel sensing and downstream signaling in vivo.19,21 Although we showed that both AMPK isoforms (α1 and α2) have similar effects on KLF2 expression in cultured endothelial cells, we chose to study the AMPK-KLF2 signaling in α2−/− mice because the in vivo results of α2−/− mice studies in fuel sensing and downstream signaling are more robust,19,21 as well as the availability of the α2−/− mice. To this end, aortas were harvested from C57BL6 wild-type and AMPKα2−/− mice, and protein lysates were prepared and used for immunoblotting analysis to assess the expression levels of KLF2 and its downstream target gene eNOS and the phosphorylation state of its upstream regulators AMPK, ERK5, and MEF2. As shown in Figure 5A, aortas from AMPKα2−/− mice exhibited reduced expressions of KLF2 and eNOS when compared to aortas from wild-type control mice. Moreover, aortas from AMPKα2−/− mice displayed a reduced phosphorylation level of AMPK, which was accompanied by decreases in ERK5 and MEF2 phosphorylations (Figure 5B). p-MEF2 en face immunostaining confirmed that the level of MEF2 phosphorylation in the thoracic endothelium of AMPKα2−/− mice was lower than that in the wild-type controls (Figure 5C). Collectively, these results indicate that AMPK is a regulator of KLF2 expression in the vascular wall in vivo, supporting our in vitro mechanistic studies.

Figure 5. AMPK mediates KLF2 expression via the ERK5-MEF2 pathway in mouse models. Expression of KLF2 and phosphorylations of ERK5 and MEF2 are higher in the aorta of wild-type mice than those in AMPKα2−/− mice. The expression levels of KLF2, eNOS, and α-tubulin (A), and the phosphorylation of AMPK, ERK5, and MEF2 (B): 2 aortic extracts from the same line were pooled and subjected to immunoblotting. Bar graphs represent 3 independent repeats (a total of 6 animals pooled in 3 samples). C, En face immunostaining of phospho-MEF2 in thoracic endothelium, and nuclei were counterstained with DAPI. The immunostained images of antiphospho-MEF2 and DAPI were obtained by confocal microscopy. Bar graph represents 4 animals in each group. *P<0.05 between the wild-type and ΑΜPΚα2−/− samples.

Discussion

In this study, we investigated the mechanotransduction mechanisms by which shear stress upregulates KLF2 expression in vascular ECs. Data collected from both in vitro and in vivo experiments revealed that AMPK is an upstream kinase regulating KLF2 expression. Our results also provide mechanistic evidence that the KLF2 induction by PS is mediated via AMPK, ERK5, and MEF2 signaling.

AMPK, functioning as a cellular energy sensor, plays important roles in vascular biology.20 Many stimuli such as hypoxia, estrogen, shear stress, adiponectin, and statins can act on the vascular EC to activate AMPK, which in turn phosphorylates eNOS Ser1177 to enhance the NO bioavailability in ECs.10,14,15,22,23 Upregulation of KLF2 expression by the atheroprotective laminar shear stress causes elevation of eNOS expression and integration of the flow-mediated endothelial atheroprotective phenotype.1,3,24 The mechanism underlying the shear stress–induced KLF2 has been investigated by several groups. Lingrel et al showed the importance of a phosphoinositide-3-kinase (PI3K)-dependent/Akt-independent pathway in the activation of KLF2 by shear stress and the involvement of nucleolin.5,25 Parmar et al showed that the flow-dependent activation of KLF2 is mediated via a MEK5/ERK5/MEF2 signaling pathway, suggesting the involvement of MAPK family in the regulation of KLF2.3 Van Thienen et al demonstrated that shear stress sustain KLF2 expression through mRNA stabilization via PI3K dependent pathway.26 However, Lingrel’s group demonstrated that KLF2 promoter can be transcriptional activated by shear stress, possibly through a shear responsive element located at the KLF2 promoter region.5 These results indicate that both mRNA stabilization and transcriptional activation are involved in the shear stress–upregulated KLF2. Here, we identify the AMPK as a key upstream regulator for ERK5 signaling that leads to KLF2 expression under shear. In RAW 264.7 cells, the PI3K inhibitor Worthmannin has been shown to abolish the nicotine-induced AMPK phosphorylation,27 indicating the potential interaction between PI3K and AMPK. However, blocking PI3K with Worthmannin or LY2943002 had little effect on shear activation of AMPK and shear induction of KLF2 (data not shown). AMPK can be activated by 2 kinases, Peutz-Jeghers syndrome kinase LKB1 or Ca2+/calmodulin-dependent protein kinase kinase (CaMKK).28,29 Our earlier work15 identified LKB1 as the upstream kinase causing AMPK Thr172 phosphorylation under steady shear, and we postulate here that PS activates AMPK via the same pathway. The mechanisms by which shear stress modulates the KLF2 expression, however, are complex and involve multiple signaling pathways.

Because both AMPK and KLF2 are regulated by shear stress and able to augment nitric oxide production, the present study focuses on the elucidation of the role that the AMPK pathway plays in regulating the shear-induction of KLF2 expression. In our previous study,16 steady laminar shear stress was found to induce a transient activation (5 to 30 minutes) of AMPK in BAECs. In the present study, PS caused a sustained activation of AMPK in cultured HUVECs. To determine whether the difference in AMPK time course was attributable to the difference in flow patterns used, we also studied the effects of steady laminar flow on HUVECs. In contrast to the transient AMPK activation in BAECs, steady flow induced a sustained AMPK phosphorylation in HUVECs (data not shown) in the same manner as pulsatile flow. Thus, the difference in the time course of the shear-activation of AMPK is most likely attribtuable to the difference in endothelial cell sources, bovine versus human.

In the current study, we identified the necessity of AMPK for the shear-induced phosphorylation of ERK5 and MEF2, and the expression of KLF2 and its downstream target genes. We also demonstrated that activation of AMPK (by AICAR) is sufficient for the induction of KLF2 expression, as well as the phosphorylation of its upstream signaling molecules ERK5 and MEF2. These results indicate an important role of AMPK in modulating the shear-activation of the ERK5/MEF2/KLF2 pathway and establish a novel link between the AMPK and the ERK5 signaling pathways.

To further validate this newly identified relationship between AMPK and ERK5/MEF2/KLF2 pathway, in vivo experiments were performed. We investigated the expressions of KLF2 and the activity levels of ERK5 and MEF2 in AMPK α2 knockout (AMPKα2−/−) mice. Although AMPK α1 is more abundant in ECs, α2 also plays an important role in EC functions (eg, migration and tube formation30). Our in vitro studies showed that AMPKα1 and α2 play similar roles in ECs (see Figures 2C and 3E). Because AMPKα2−/− plays more important roles in fuel sensing and downstream signaling in vivo19,21 and because of the availability of the AMPKα2−/− mice, we studied the AMPK-KLF2 signaling in the vessels of AMPKα2−/− mice. Our results demonstrated that KLF2 expression was significantly reduced and the phosphorylations of ERK5, MEF2, and eNOS were greatly attenuated in the aortas of AMPKα2−/− mice. Because of the exclusive expression of KLF2 in ECs, it is inferred that the decrease in aortic KLF2 expression in AMPKα2−/− mice would be attributable to that in endothelium. This notion was further demonstrated by phospho-MEF2 en face immunostaining.

In summary, our results demonstrated that AMPK is an upstream signaling molecule of the ERK5/MEF2/KLF2 pathway and documented the requirement of AMPK for the activation of ERK5/MEF2 signaling pathway and expression of KLF2 in the mouse vasculature. Our findings suggest that the PS activation of the AMPK/ERK5/MEF2/KLF2 pathway may play an important role in the regulation of vascular homeostasis.

A.Y. and W.W. contributed equally to this study.

Received December 23, 2008; revision accepted August 6, 2009.

We acknowledge the technical supports from Phu Nguyen and Mark Kuie-Chun Wang.

Sources of Funding

This work was supported in part by National Institutes of Health Research Grants HL085195, HL080518, and HL064382 (to S.C.), HL77448 and HL89940 (to J.S.), and HL76686 (to G.G.-C).

Disclosures

None.

Footnotes

Correspondence to Shu Chien, MD, PhD, Department of Bioengineering, UCSD, 9500, Gilman Drive, La Jolla, CA 92093-0412. E-mail

References

  • 1 Dekker RJ, van Soest S, Fontijn RD, Salamanca S, de Groot PG, VanBavel E, Pannekoek H, Horrevoets AJ. Prolonged fluid shear stress induces a distinct set of endothelial cell genes, most specifically lung Kruppel-like factor (KLF2). Blood. 2002; 100: 1689–1698.CrossrefMedlineGoogle Scholar
  • 2 Dekker RJ, van Thienen JV, Rohlena J, de Jager SC, Elderkamp YW, Seppen J, de Vries CJ, Biessen EA, van Berkel TJ, Pannekoek H, Horrevoets AJ. Endothelial KLF2 links local arterial shear stress levels to the expression of vascular tone-regulating genes. Am J Pathol. 2005; 167: 609–618.CrossrefMedlineGoogle Scholar
  • 3 Parmar KM, Larman HB, Dai G, Zhang Y, Wang ET, Moorthy SN, Kratz JR, Lin Z, Jain MK, Gimbrone MA Jr, Garcia-Cardena G. Integration of flow-dependent endothelial phenotypes by Kruppel-like factor 2. J Clin Invest. 2006; 116: 49–58.CrossrefMedlineGoogle Scholar
  • 4 Bieker JJ. Kruppel-like factors: three fingers in many pies. J Biol Chem. 2001; 276: 34355–34358.CrossrefMedlineGoogle Scholar
  • 5 Huddleson JP, Ahmad N, Srinivasan S, Lingrel JB. Induction of KLF2 by fluid shear stress requires a novel promoter element activated by a phosphatidylinositol 3-kinase-dependent chromatin-remodeling pathway. J Biol Chem. 2005; 280: 23371–23379.CrossrefMedlineGoogle Scholar
  • 6 Wang N, Miao H, Li YS, Zhang P, Haga JH, Hu Y, Young A, Yuan S, Nguyen P, Wu CC, Chien S. Shear stress regulation of Kruppel-like factor 2 expression is flow pattern-specific. Biochem Biophys Res Commun. 2006; 341: 1244–1251.CrossrefMedlineGoogle Scholar
  • 7 Fledderus JO, van Thienen JV, Boon RA, Dekker RJ, Rohlena J, Volger OL, Bijnens AP, Daemen MJ, Kuiper J, van Berkel TJ, Pannekoek H, Horrevoets AJ. Prolonged shear stress and KLF2 suppress constitutive proinflammatory transcription through inhibition of ATF2. Blood. 2007; 109: 4249–4257.CrossrefMedlineGoogle Scholar
  • 8 Das H, Kumar A, Lin Z, Patino WD, Hwang PM, Feinberg MW, Majumder PK, Jain MK. Kruppel-like factor 2 (KLF2) regulates proinflammatory activation of monocytes. Proc Natl Acad Sci U S A. 2006; 103: 6653–6658.CrossrefMedlineGoogle Scholar
  • 9 Nagata D, Mogi M, Walsh K. AMP-activated protein kinase (AMPK) signaling in endothelial cells is essential for angiogenesis in response to hypoxic stress. J Biol Chem. 2003; 278: 31000–31006.CrossrefMedlineGoogle Scholar
  • 10 Chen H, Montagnani M, Funahashi T, Shimomura I, Quon MJ. Adiponectin stimulates production of nitric oxide in vascular endothelial cells. J Biol Chem. 2003; 278: 45021–45026.CrossrefMedlineGoogle Scholar
  • 11 Chen ZP, Mitchelhill KI, Michell BJ, Stapleton D, Rodriguez-Crespo I, Witters LA, Power DA, Ortiz de Montellano PR, Kemp BE. AMP-activated protein kinase phosphorylation of endothelial NO synthase. FEBS Lett. 1999; 443: 285–289.CrossrefMedlineGoogle Scholar
  • 12 Morrow VA, Foufelle F, Connell JM, Petrie JR, Gould GW, Salt IP. Direct activation of AMP-activated protein kinase stimulates nitric-oxide synthesis in human aortic endothelial cells. J Biol Chem. 2003; 278: 31629–31639.CrossrefMedlineGoogle Scholar
  • 13 Drew BG, Fidge NH, Gallon-Beaumier G, Kemp BE, Kingwell BA. High-density lipoprotein and apolipoprotein AI increase endothelial NO synthase activity by protein association and multisite phosphorylation. Proc Natl Acad Sci U S A. 2004; 101: 6999–7004.CrossrefMedlineGoogle Scholar
  • 14 Schulz E, Anter E, Zou MH, Keaney JF Jr. Estradiol-mediated endothelial nitric oxide synthase association with heat shock protein 90 requires adenosine monophosphate-dependent protein kinase. Circulation. 2005; 111: 3473–3480.LinkGoogle Scholar
  • 15 Zhang Y, Lee TS, Kolb EM, Sun K, Lu X, Sladek FM, Kassab GS, Garland T Jr, Shyy JY. AMP-activated protein kinase is involved in endothelial NO synthase activation in response to shear stress. Arterioscler Thromb Vasc Biol. 2006; 26: 1281–1287.LinkGoogle Scholar
  • 16 Guo D, Chien S, Shyy JY. Regulation of endothelial cell cycle by laminar versus oscillatory flow: distinct modes of interactions of AMP-activated protein kinase and Akt pathways. Circ Res. 2007; 100: 564–571.LinkGoogle Scholar
  • 17 Gimbrone MA Jr, Cotran RS, Folkman J. Human vascular endothelial cells in culture. Growth and DNA synthesis. J Cell Biol. 1974; 60: 673–684.CrossrefMedlineGoogle Scholar
  • 18 Frangos JA, Eskin SG, McIntire LV, Ives CL. Flow effects on prostacyclin production by cultured human endothelial cells. Science. 1985; 227: 1477–1479.CrossrefMedlineGoogle Scholar
  • 19 Viollet B, Andreelli F, Jorgensen SB, Perrin C, Geloen A, Flamez D, Mu J, Lenzner C, Baud O, Bennoun M, Gomas E, Nicolas G, Wojtaszewski JF, Kahn A, Carling D, Schuit FC, Birnbaum MJ, Richter EA, Burcelin R, Vaulont S. The AMP-activated protein kinase alpha2 catalytic subunit controls whole-body insulin sensitivity. J Clin Invest. 2003; 111: 91–98.CrossrefMedlineGoogle Scholar
  • 20 Kato Y, Zhao M, Morikawa A, Sugiyama T, Chakravortty D, Koide N, Yoshida T, Tapping RI, Yang Y, Yokochi T, Lee JD. Big mitogen-activated kinase regulates multiple members of the MEF2 protein family. J Biol Chem. 2000; 275: 18534–18540.CrossrefMedlineGoogle Scholar
  • 21 Jorgensen SB, Wojtaszewski JF, Viollet B, Andreelli F, Birk JB, Hellsten Y, Schjerling P, Vaulont S, Neufer PD, Richter EA, Pilegaard H. Effects of alpha-AMPK knockout on exercise-induced gene activation in mouse skeletal muscle. FASEB J. 2005; 19: 1146–1148.CrossrefMedlineGoogle Scholar
  • 22 Li J, Hu X, Selvakumar P, Russell RR III, Cushman SW, Holman GD, Young LH. Role of the nitric oxide pathway in AMPK-mediated glucose uptake and GLUT4 translocation in heart muscle. Am J Physiol Endocrinol Metab. 2004; 287: E834–E841.CrossrefMedlineGoogle Scholar
  • 23 Xenos ES, Stevens SL, Freeman MB, Cassada DC, Goldman MH. Nitric oxide mediates the effect of fluvastatin on intercellular adhesion molecule-1 and platelet endothelial cell adhesion molecule-1 expression on human endothelial cells. Ann Vasc Surg. 2005; 19: 386–392.CrossrefMedlineGoogle Scholar
  • 24 Lin Z, Kumar A, SenBanerjee S, Staniszewski K, Parmar K, Vaughan DE, Gimbrone MA Jr, Balasubramanian V, Garcia-Cardena G, Jain MK. Kruppel-like factor 2 (KLF2) regulates endothelial thrombotic function. Circ Res. 2005; 96: e48–e57.LinkGoogle Scholar
  • 25 Huddleson JP, Ahmad N, Lingrel JB. Up-regulation of the KLF2 transcription factor by fluid shear stress requires nucleolin. J Biol Chem. 2006; 281: 15121–15128.CrossrefMedlineGoogle Scholar
  • 26 van Thienen JV, Fledderus JO, Dekker RJ, Rohlena J, van Ijzendoorn GA, Kootstra NA, Pannekoek H, Horrevoets AJ. Shear stress sustains atheroprotective endothelial KLF2 expression more potently than statins through mRNA stabilization. Cardiovasc Res. 2006; 72: 231–240.CrossrefMedlineGoogle Scholar
  • 27 Cheng PY, Lee YM, Law KK, Lin CW, Yen MH. The involvement of AMP-activated protein kinases in the anti-inflammatory effect of nicotine in vivo and in vitro. Biochem Pharmacol. 2007; 74: 1758–1765.CrossrefMedlineGoogle Scholar
  • 28 Hawley SA, Boudeau J, Reid JL, Mustard KJ, Udd L, Makela TP, Alessi DR, Hardie DG. Complexes between the LKB1 tumor suppressor, STRAD alpha/beta and MO25 alpha/beta are upstream kinases in the AMP-activated protein kinase cascade. J Biol. 2003; 2: 28.CrossrefMedlineGoogle Scholar
  • 29 Hurley RL, Anderson KA, Franzone JM, Kemp BE, Means AR, Witters LA. The Ca2+/calmodulin-dependent protein kinase kinases are AMP-activated protein kinase kinases. J Biol Chem. 2005; 280: 29060–29066.CrossrefMedlineGoogle Scholar
  • 30 Zou MH, Wu Y. AMP-activated protein kinase activation as a strategy for protecting vascular endothelial function. Clin Exp Pharmacol Physiol. 2008; 35: 535–545.CrossrefMedlineGoogle Scholar