Skip main navigation

MicroRNA-210 Enhances Fibrous Cap Stability in Advanced Atherosclerotic Lesions

Originally publishedhttps://doi.org/10.1161/CIRCRESAHA.116.309318Circulation Research. 2017;120:633–644

Abstract

Rationale:

In the search for markers and modulators of vascular disease, microRNAs (miRNAs) have emerged as potent therapeutic targets.

Objective:

To investigate miRNAs of clinical interest in patients with unstable carotid stenosis at risk of stroke.

Methods and Results:

Using patient material from the BiKE (Biobank of Karolinska Endarterectomies), we profiled miRNA expression in patients with stable versus unstable carotid plaque. A polymerase chain reaction–based miRNA array of plasma, sampled at the carotid lesion site, identified 8 deregulated miRNAs (miR-15b, miR-29c, miR-30c/d, miR-150, miR-191, miR-210, and miR-500). miR-210 was the most significantly downregulated miRNA in local plasma material. Laser capture microdissection and in situ hybridization revealed a distinct localization of miR-210 in fibrous caps. We confirmed that miR-210 directly targets the tumor suppressor gene APC (adenomatous polyposis coli), thereby affecting Wnt (Wingless-related integration site) signaling and regulating smooth muscle cell survival, as well as differentiation in advanced atherosclerotic lesions. Substantial changes in arterial miR-210 were detectable in 2 rodent models of vascular remodeling and plaque rupture. Modulating miR-210 in vitro and in vivo improved fibrous cap stability with implications for vascular disease.

Conclusions:

An unstable carotid plaque at risk of stroke is characterized by low expression of miR-210. miR-210 contributes to stabilizing carotid plaques through inhibition of APC, ensuring smooth muscle cell survival. We present local delivery of miR-210 as a therapeutic approach for prevention of atherothrombotic vascular events.

Introduction

Atherosclerosis is characterized by the development of vascular lesions commonly referred to as plaques or atheromas and has various stages, of which most remain clinically silent.1 Disruption of a vulnerable atherosclerotic plaque classically marks the onset of clinical symptoms.1 Identification and stabilization of a vulnerable plaque would be of great value in patients at risk of lesion rupture.

Editorial, see p 596

In This Issue, see p 593

Stroke is the second most common cause of death2 and major cause of disability worldwide,2 with survivors often depending on lifelong care. Carotid stenosis is the second most common predecessor of ischemic stroke,3 and carotid endarterectomy (CEA; and to a lesser extent carotid artery stenting) are accepted as secondary, but also primary preventive therapy.2,4,5 With new imaging techniques, vulnerable plaques at risk of rupture can be identified with increasing accuracy,6 but in the majority of cases, the perioperative surgical risk of ≈3% still outweighs the risk of plaque rupture in asymptomatic carotid stenosis carriers.7 As a result, CEA and carotid artery stenting are currently unfavorable for most of these individuals.8 Detection and stabilization of a vulnerable plaque by influencing the local disease process biologically would provide a sophisticated solution for asymptomatic plaque carriers at risk of stroke.

MicroRNAs (miRNAs) are 20- to 22-nucleotide long endogenous RNA molecules and known as post-transcriptional negative regulators of gene expression.9 Up to 60% of all mammalian genes are reported to be under the influence of miRNAs, many of which are highly conserved throughout species.10 Together, these facts imply a disease-modifying potential for miRNA mimics (premiRs) and inhibitors (antagomiRs), and indeed antagomiRs have proven their therapeutic potential in clinical trials.11 Unlike mRNA, which is prone to degradation in the circulation, miRNAs associate with diverse types of stabilizing carriers such as microparticles and exosomes,12 allowing them to be detected as disease biomarkers.13

We used a human array of lesion site plasma, obtained during CEA and laser capture microdissection (LCM) of plaque tissue, to identify miR-210 repression in high-grade carotid stenosis patients with symptoms of atherosclerotic plaque rupture versus asymptomatic CEA subjects. Using 2 distinct murine plaque models, we were able to decipher an antiapoptotic role for miR-210 in smooth muscle cell (SMC)–enriched fibrous caps, altering the pathological consequence in vivo. Exposing vascular cells to various disease-relevant stimuli in vitro allowed us to pinpoint APC (adenomatous polyposis coli) as a miR-210 target essential in carotid plaque vulnerability.

Methods

CEA Plasma Array

Patients undergoing surgery for symptomatic or asymptomatic high-grade (>50% NASCET [North American Symptomatic Carotid Endarterectomy Trial]) carotid stenosis at the Department for Vascular Surgery, Karolinska University Hospital, were consecutively enrolled in the BiKE (Biobank of Karolinska Endarterectomies) and clinical data recorded on admission. The BiKE study cohort demographics and details of sample processing including control (normal artery) samples have been previously described.14 Briefly, symptoms of plaque instability were defined as transient ischemic attack, minor stroke, or amaurosis fugax. Patients without qualifying symptoms within 6 months before surgery were categorized as asymptomatic and indication for CEA based on results from the ACST (Asymptomatic Carotid Surgery Trial).7 Patients with known atrial fibrillation were excluded. For this study, CEA tissue and blood samples from n=7 symptomatic and n=5 asymptomatic subjects were collected during surgery. We validated our findings in local plasma samples in a separate BiKE validation cohort of 7 symptomatic versus 7 asymptomatic patients. During clamping of the carotid artery for 5 minutes before opening of the vessel, blood from the lesion site was sampled in EDTA-containing tubes (BD Pharmingen, Franklin Lakes, NJ, USA). The resultant plasma samples were stored at −80°C before further processing. Hemolytic plasma samples were excluded from miRNA analysis (Methods in the Online Data Supplement). All studies were approved by the Ethical Committee of Northern Stockholm; patient informed consent was obtained according to the Declaration of Helsinki.

Ruptured Versus Stable Carotid Plaques for Histology and miR-210 In Situ Hybridization

For histology and miR-210 in situ hybridization (ISH), we used CEA material from the Munich Vascular Biobank (Department of Vascular Surgery, Technical University Munich, Germany). These plaques were morphologically graded according to the Atherosclerosis Council of the American Heart Association classification,15 with or without a vulnerable fibrous cap according to Redgrave et al.16 Tissue preparation is described in the Methods in the Online Data Supplement.

LCM of Vulnerable Versus Stable Carotid Plaques

Human atherosclerotic carotid artery lesions were obtained from patients undergoing CEA for asymptomatic (n=10) or symptomatic (n=10) carotid stenosis. A detailed description of the LCM is provided in the Methods in the Online Data Supplement.

Selection of miR-210 Targets for Functional Analysis

Information on experimentally validated17 or predicted18 miR-210 targets was extracted from the literature to obtain a workable gene list. Next, expression of miR-210 target genes in carotid plaques was examined in previously published BiKE data sets (Gene Expression Omnibus accession number GSE21545),14 to identify significantly deregulated genes comparing plaques versus control arteries and plaque from symptomatic versus asymptomatic subjects. Finally, miR-210 target gene expression in plaques was validated by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis (Methods in the Online Data Supplement).

APC Luciferase Reporter Assay

Luciferase reporter assay was performed as described previously.19 In brief, HEK293 cells (Public Health England Culture Collections, Salisbury, United Kingdom) or human carotid artery SMC (HCtASMCs; Cell Applications, San Diego, CA) were seeded on 24-well plates (1×105 cells/well). At 50% to 60% confluence, cells were transfected with luciferase reporter plasmid pLS, pLS-APC-3′ untranslated region (3′UTR), or its mutant (100 ng/well; Active Motif, Switchgear Genomics and Thermo Fisher Scientific, Waltham, MA), together with control or premiR-210 (10 nmol/L final concentration) using FuGENE HD Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s protocol. After a 24-hour transfection period, luciferase activity was quantified using the LightSwitch Luciferase Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions.

Animal Studies

Rat Carotid Artery Balloon Injury Model

Injury of the common carotid artery in rats was performed as previously described20 in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). For experimental and sample-processing details, please refer to the Methods in the Online Data Supplement.

Mouse Atherosclerosis/Carotid Plaque Rupture Model

All experiments were performed in male, 12-week-old apolipoprotein E knockout (Apoe−/− C57Bl/6J) mice (Taconic Biosciences, Hudson, NY), weighing 25 to 30 g, and in accordance with the guidelines on laboratory animal use issued by the Swedish Board of Agriculture. To assess effect of miR-210 modulation on atherosclerosis per se, mice were injected with miR-210 modulators once per week for 4 weeks and euthanized at 16 weeks of age. To induce carotid plaque rupture, we used a modified version of the carotid ligation/cast approach first described by Sasaki et al21 (n=48). For experimental and sample-processing details, please refer to the Methods in the Online Data Supplement and the Online Movie file.

In Vivo miR-210 Modulation

For inhibition of miR-210, we used 10 mg/kg locked nucleic acid–carried anti–miR-210 (Exiqon, Vedbaek, Denmark) diluted in PBS. Mice receiving inhibitors were injected intraperitoneally once per week (n=6, atherosclerosis) or 1 day before cast placement (n=18, plaque rupture). Control animals (n=14, plaque rupture) received 10 mg/kg locked nucleic acid–carried scrambled miRNAs following the manufacturer’s instructions. For tracking purposes, we used FAM (carboxyfluorescein)-labeled locked nucleic acid oligonucleotides in 2 of these animals. For miR-210 overexpression, we used 2 mg/kg miR-210 mimic (Ambion; Thermo Fisher Scientific) using Jet-PEI (Polyplus-Transfection, Illkirch-Graffenstaden, France) as vector. Mimics were injected intraperitoneally once per week (n=6, atherosclerosis) or on 5 consecutive days starting 1 day before cast placement (n=26, plaque rupture). Controls received Jet-PEI carried mismatch (scrambled) control miRNAs (n=6, atherosclerosis; n=11, plaque rupture) to a final concentration of 0.5 mg/kg, according to the manufacturer’s instructions.

Tissue Histology and Immunohistochemistry

Tissue preparation and histology methods are described in the Methods in the Online Data Supplement. For immunohistochemistry, we used standard biotin-avidin-immunoperoxidase methods with the following Abcam (Cambridge, United Kingdom) primary antibodies: α–smooth muscle actin, von Willebrand factor, APC, and galectin (Macrophage-2 glycoprotein). CD4 and CD19 antibodies were obtained from BD Pharmingen and prediluted CD3 antibody from Biocare Medical (Concord, CA).

For immunofluorescent staining, we used standard immunofluorescent techniques modified for mouse-on-mouse staining (M.O.M. Basic Kit; Vector Laboratories, Peterborough, United Kingdom) with an antibody against fibrin that does not cross-react with fibrinogen.22 As secondary antibody, we used Alexa Fluor 488 goat anti-mouse secondary antibody (Thermo Fisher Scientific) at a 1:200 dilution. We counterstained with Hoechst (bisBenzimide H 33258; Sigma Aldrich, St. Louis, MO). All antibodies and dilutions are listed in Online Table V.

In Situ Hybridization

For ISH, we used an Exiqon miRCURY locked nucleic acid DIG (digoxigenin)-labeled probe (5′-3′ sequence: /5DigN/TCAGCCGCTGTCACACGCACAG/3Dig_N/) with the accompanying kit and protocol (Exiqon). In brief, tissue sections were either deparaffinized (formalin-fixed paraffin embedded) or thawed (frozen) and rehydrated. Nucleases were inactivated with proteinase K followed by a 2-hour hybridization at hybridization temperature (62°C for miR-210). Slides were washed in saline–sodium citrate buffers with subsequent DIG detection methods. Nuclear counterstaining was performed with Nuclear Fast Red (Sigma Aldrich).

In Vitro Experiments

Cell Shear Stress Exposure Model

Experimental details for studies in primary human carotid artery smooth muscle cells (SMCs) and endothelial cells (HCtASMCs and human carotid artery endothelial cells; Cell Applications), using the Streamer apparatus (Flexcell International Corporation, Burlington, VT) with adjustable flow and shear stress conditions are described in the Methods in the Online Data Supplement.

Cell Stimulation and miRNA Modulation

HCtASMCs were transfected with miRNA modulators or scrambled control (Ambion; Thermo Fisher Scientific) using lipofectamine RNAiMAX Transfection Agent (Invitrogen; Thermo Fisher Scientific). To assess cell proliferation, miR-210 modulator or control transfection was followed by Vybrant MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay (Thermo Fisher Scientific) according to the manufacturer’s protocol. For fluorescent microscopy and fluorescence-activated cell sorter analysis, Cy3-labeled scrambled control oligonucleotides were used. Transfection time was 24 hours. A line of nonstarved cells served as normalization control. Experiments were repeated 3×. Further details are described in the Methods in the Online Data Supplement.

p53 Knockdown

HCtASMCs (Lonza, Walkersville, MD; passages 4–5) were propagated in SmGM-2 (smooth muscle growth medium-2) growth media (Lonza) containing 5% fetal bovine serum. Cells were serum starved in basal media (SmBM) for 48 hours or placed in the Streamer for 1 hour. p53 inhibition studies were completed by adding 10 μmol/L pifithrin-α (Merck Millipore, Darmstadt, Germany), diluted in dimethyl sulfoxide, to the cell culture media. Control cells received dimethyl sulfoxide only.

Terminal Deoxynucleotidyl Transferase–Mediated dUTP (deoxyuridine triphosphate) Nick-End Labeling Assay

Terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL) assay was performed using the Click-iT TUNEL Alexa Fluor Imaging Kit (Invitrogen) in accordance with the manufacturer’s protocol (Methods in the Online Data Supplement).

Fluorescent Immunocytochemical Staining

Fluorescent immunocytochemical staining was performed on HCtASMCs grown on cover slips. Cells at 70% to 80% confluency were transfected with either APC siRNA or scrambled control oligonucleotides (30 μmol/L; Thermo Fisher Scientific) for 48 hours with or without etoposide (Sigma Aldrich) treatment at a final concentration of 10 μmol/L for 24 hours. After fixation and permeabilization, the cells were incubated with caspase-3 antibody (Merck Millipore; dilution 1:50) or APC antibody (Abcam; dilution 1:50) following standard immunocytochemistry techniques described in the Methods in the Online Data Supplement.

Wnt (Wingless-related integration site) Signaling Activity Assay

Wnt–β-catenin signaling activity analyses were performed using a T-cell factor/lymphoid enhancer factor (TCF/LEF) luciferase reporter assay (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Briefly, HEK293 cells (Public Health England Culture Collections) or HCtASMCs (Cell Applications) were seeded on 96-well plates (2×104 cells/well) containing anti–miR-210, miR-210 mimic or scrambled oligonucleotides (all from Ambion; Thermo Fisher Scientific) and a TCF/LEF responsive firefly luciferase reporter construct (Qiagen) or negative control reporter, using DharmaFECT Duo transfection reagent (GE Healthcare, Little Chalfont, United Kingdom). After 24 hours, transfection medium was replaced by growth medium enriched with 10 μmol/L lithium chloride, to stimulate endogenous Wnt signaling activity. To confirm successful transfection, cells were cotransfected with a Renilla luciferase construct. Forty-eight hours after transfection, we analyzed firefly and Renilla luciferase activity using a luciferase reporter assay (Promega, Madison, WI) on a GloMax-96 Microplate Luminometer (Promega).

RNA Isolation and qPCR Analysis

Sample preparation and standard qPCR analysis is available in Methods in the Online Data Supplement. As internal normalization controls, spike-in C. elegans miR-39, small nucleolar RNA, C/D box 48 (RNU48, human), SNORD87 small nucleolar RNA (rat), and small nucleolar RNA, MBII-202 (sno202, mouse) were used. Housekeeping mRNA genes used were RPLP0 (ribosomal protein lateral stalk subunit P0; human), Hprt1 (hypoxanthine phosphoribosyltransferase [1]; rat), and Hprt (mouse). Mature miRNA sequences, control sequences, and gene NCBI Reference Sequences are listed in Online Tables VI, VII, and VIII, respectively.

Western Blot Analysis

Protein isolation is available in Methods in the Online Data Supplement. Western blot was performed with an anti-human APC antibody (ab15270, dilution 1:500, Abcam). APC Western blotting showed 2 bands (Online Figure VIIB), 1 for the full-length protein (300 kDa) and 1 for a truncated splice form (120 kDa). This truncated APC has been shown in cancer cells and is associated with proliferation.23 β-actin (A1978, dilution 1:5000; Sigma Aldrich) served as loading control. Densitometric quantification was performed using ImageJ64 software. Western blotting was performed with n=3 for both treatment groups.

Statistical Methods

SPSS Statistics version 22 (IBM) was used to analyze patient data. To compare 2 groups, a Student t test was used. Paired data were analyzed by paired-samples t test. Differences between ≥2 groups versus a control group were analyzed with 1-way ANOVA plus Bonferroni correction for multiple comparisons. Percentages were analyzed with χ2 testing. Nonparametric data were analyzed by Mann–Whitney U test. Statistical analysis for experiment data was performed using Graphpad Prism software version 6.0b. Differences in RNA expression were calculated as fold change versus control using the mean ΔCt (defined as Cttarget RNA−Ctendogenous control) within groups.

Results

miR-210 Is Downregulated in Local Plasma and Tissue of the Fibrous Cap in Patients With Symptomatic Carotid Stenosis

Patients undergoing CEA for either symptomatic or asymptomatic carotid artery disease were selected based on symptoms (Online Table I). Microarray analysis of plasma locally sampled close to the carotid plaque lesion showed that 2 out of 742 miRNAs (miR-210 and miR-29c) were downregulated in 7 symptomatic versus 5 asymptomatic patients. Six miRNAs (miR-30c, miR-15b, miR-191, miR-500, miR-30d, and miR-150) were upregulated (Figure 1A; Online Figure IA). Out of these 8 deregulated miRNAs, only miR-210 was significantly altered throughout multiple testing using Bonferroni post hoc analysis. In plasma from a separate second BiKE patient cohort (Online Table II) of symptomatic versus asymptomatic CEA subjects (7 versus 7), a 1.5-fold downregulation of miR-210 was confirmed. In peripherally sampled arterial plasma taken at the time of surgical intervention, miR-210 was detected in only 5 out of 14 individuals, and miR-210 was not significantly downregulated in patients versus controls (data not shown).

Figure 1.

Figure 1. Human carotid artery microRNA (miRNA) profiling.A, Of 742 miRNAs tested in locally sampled human plasma, 8 were deregulated in symptomatic vs asymptomatic carotid endarterectomy (CEA) patients (orange dots) as calculated by Student t test. miR-210 solely reached Bonferroni cut-off. n=5 (asymptomatic); n=7 (symptomatic). B, Polymerase chain reaction (PCR) analysis of symptomatic vs asymptomatic patient plaques did not reveal significant differences, although miR-210 showed significant alterations when compared with control (plaque-free iliac) arteries. Mean+SEM. C, miR-210 has a distinct luminal localization (arrows) in healthy tissue (control) and in the fibrous cap (stable). Immunohistochemical staining for α-smooth muscle actin (α-SMA, arrows) and von Willebrand factor (vWF) shows that miR-210 expression associates with carotid smooth muscle and endothelial cells. APC (adenomatous polyposis coli) colocalized with smooth muscle cells in ruptured, but not stable, plaques. Bars: 100 μm. D, H&E (hematoxylin and eosin) staining of whole carotid plaque showing tissue heterogeneity. The dashed line marks the atherosclerotic fibrous cap. E, Laser capture microdissection (LCM) of carotid fibrous caps showed significantly decreased miR-210 and increased APC mRNA in ruptured vs stable plaques. Mean+SEM. *P<0.05 in Student t test, n=10 per group. F, In HEK293 cells, transfection with premiR-210 inhibited APC luciferase activity. Mean+SEM. **P<0.01. G, miR-210 targeted APC through binding to BS-1, but not BS-2 and BS-3. Mean+SEM. **P<0.01: ***P<0.001 in 1-way ANOVA, n=3 per group. BS indicates binding site; EV, empty vector; FC, fibrous cap; L, lumen; NC, necrotic core; scr, scrambled control; T, thrombus; and UTR, untranslated region.

By qRT-PCR analysis of RNA extracted from transverse plaque sections, miR-210 was the only miRNA out of 8 in locally sampled plasma that was substantially and significantly downregulated in whole plaque compared with healthy arterial tissue (Figure 1B). We could not detect any difference in miR-210 expression in lesions originating from symptomatic versus asymptomatic patients (Online Figure IB). To better localize and define a potential role of miR-210 in plaque vulnerability, we performed ISH for miR-210 in histologically graded ruptured (Atherosclerosis Council of the American Heart Association15; type VI) versus stable (type V) carotid plaques with a cap thickness either below (ruptured) or above (stable) the critical 200 μm as defined by Redgrave et al.16 Patient characteristics for this cohort are listed in Online Table III.

Here, miR-210 had a distinct intima-medial localization in control tissue and stable plaques, which almost completely vanished in ruptured lesions (Figure 1C; Online Figure IC and ID), indicating that the unobserved difference in miR-210 expression in whole plaque tissue is mainly attributable to the heterogeneity of advanced human atherosclerotic lesions (Figure 1D). Moreover, miR-210 associated with endothelial cells and SMC, and to some extent T cells, whereas APC was associated with SMCs exclusively in ruptured plaques (Figure 1C; Online Figure IC). Localization of miR-210 in the carotid plaque fibrous cap was confirmed in LCM-generated tissue from fibrous caps, where miR-210 expression was, in concordance with the results of locally drawn plasma, substantially decreased in symptomatic versus asymptomatic patients (Figure 1E). In addition to miR-210, we evaluated the expression of other well-established atherosclerosis-associated miRNAs, such as miR-21,24 miR-29b,25 miR-126,26 and miR-145,27 as well as all other miRNAs identified in our initial local plasma analysis. Apart from miR-210, only miR-21 was significantly deregulated (down) in stable versus ruptured (Online Figure IE).

To functionally address the role of miR-210 in plaque instability, we examined expression of all experimentally validated miR-210 target genes (Online Table IV),17 which were deregulated in previously published BiKE microarray data sets.14 Among these, APC emerged as a well-known tumor suppressor gene and miR-210 target.28,29 APC has an important inhibitory function in canonical Wnt signaling, which in SMCs contributes to the balance between proliferation and apoptosis.30,31 Because these mechanisms are assumed to be critical in fibrous cap stability, we addressed APC expression in LCM-dissected fibrous caps from ruptured versus stable plaques and found APC upregulated (Figure 1E), corresponding with the observed miR-210 changes. Of note, similar to miR-210, APC was not altered in whole plaque tissue from symptomatic versus asymptomatic patients (Online Figure IF). Other miR-210 targets contributing to atherosclerosis via apoptosis (PTPN1),32 angiogenesis (EFNA3),28 and metabolism (ICSU)33 were not deregulated in the BiKE tissue microarray data sets.14

miR-210 Targets APC mRNA at Its 3′-UTR

APC is a predicted miR-210 target but has not yet been strongly confirmed as such.17 To determine whether miR-210 directly targets APC at its 3′-UTR, HEK293 cells or HCtASMCs transfected either with empty (control) pLS-promoter or pLS-APC 3′UTR were coincubated with scrambled control or premiR-210. Relative luciferase activity was significantly reduced in premiR-210–treated cells, suggesting that miR-210 targets APC through its 3′-UTR (Figure 1F; Online Figure IIC and IID).34

In the search for potential miR-210 binding sites at the APC 3′-UTR, we used the RNA22 program as described previously.18 We identified 3 putative miR-210 binding sites (BS-1, BS-2, and BS-3) in the 5′ of the APC 3′-UTR (miRNA:mRNA free folding energy cut-off −25 kcal/mol; Online Figure IIA and IIB). As shown in Figure 1G, deletion of the first putative binding site (BS-1, nt 602–623; pLS-APC-3′UTRΔBS1), but not the second or third (BS-2 or BS-3; nt 244–283; pLS-APC-3′UTRΔBS2, 3), abolished the inhibition of luciferase activity on miR-210 overexpression, suggesting miR-210 targeting via the BS-1 site.

miR-210 Is Repressed in Experimental Carotid Artery Remodeling

Carotid artery balloon injury in rats is a well-established model to study the initial response to vascular injury20 and triggers remodeling and neointima formation via SMC proliferation and survival as depicted in Figure 2A. In carotid artery tissue from male Sprague–Dawley rats, we detected a significant decrease in miR-210 expression in injured versus intact (contralateral) rat carotid arteries during the first 2 weeks after injury (Figure 2B). ISH for miR-210 confirmed that the tunica media–localized miR-210 was lower in injured versus intact rat carotid arteries (Online Figure IIE).

Figure 2.

Figure 2. miR-210 and its targets are deregulated in rat carotid balloon injury.A, Descriptive cartoon of the balloon injury model to cause endothelial denudation and smooth muscle cell dedifferentiation. B, During the first 2 wk after balloon injury, quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis of rat carotid tissue shows downregulation of miR-210 and upregulation of Apc (adenomatous polyposis coli) microRNA (mRNA). Mean+SEM. ***P<0.001; **P<0.01; *P<0.05 in paired-samples t test of injured vs intact (left vs right) artery within the same animal. n=6 per group per time point.

Concordant with miR-210 downregulation after balloon injury in rats, carotid arterial tissue showed significant miR-210 target mRNA upregulation of Apc during the critical 2-week period after injury, when compared with the contralateral intact carotid artery (Figure 2B).

miR-210 Located in the Fibrous Cap Influences Experimental Atherosclerotic Plaque Stability

In a more advanced atherosclerosis setting, morphological analysis revealed that incomplete carotid artery ligation followed by cast placement in male Apoe−/− mice (Figure 3A) results in a variety of pathological changes similar to vulnerable atherosclerotic lesion formation, including an accelerated necrotic core evolution, intraplaque hemorrhage, thinned fibrous caps, endothelial fissures, and eventual atherothrombotic events (Figure 3B; Online Figure IIIA). The plaque-triggering ligation in this model is based on altered shear stress rather than flow cessation, and we did not experience any flow cessation (Online Movie). The overall inducible plaque rupture rate was 58%. In carotid arterial tissue from mice with ruptured versus nonruptured or stable plaques and contralateral control arteries (left side; Online Figure IIIB), no significant difference in miR-210 expression was detected (Online Figure IIIC).

Figure 3.

Figure 3. miR-210 in mouse carotid plaque rupture.A, Descriptive cartoon of the mouse carotid plaque rupture model. At 12 wk of age, incomplete carotid artery ligation is induced directly below the bifurcation. Within 4 wk, a plaque forms proximal to the ligation. Placement of a cast with a conically shaped internal lumen results in plaque rupture in 58% of animals. Bar, 1 mm. B, Histological images stained with hematoxylin and eosin (HE), Oil Red O, and cross-linked fibrin of stable and ruptured carotid plaque in the mouse carotid plaque rupture model. C, As in human lesions, miR-210 localizes toward the fibrous cap and is associated with smooth muscle cells (SMCs), as shown by in situ hybridization of miR-210 and SMA staining in mouse carotid plaque tissue. Arrow, plaque fibrous cap defect. Bars: 100 μm. α-SMA indicates α-smooth muscle actin; APC, adenomatous polyposis coli; FC, fibrous cap; L, lumen; NC, necrotic core; and T, thrombus.

ISH of ruptured versus nonruptured carotid arteries confirmed that whole-vessel miR-210 expression was not significantly altered between the groups and control arteries, but as in human lesions, the fibrous caps of ruptured plaques showed less miR-210 expression when compared with nonruptured plaques and control carotid arterial tissue (Figure 3C). Staining for α–smooth muscle actin indicated that the fibrous cap of ruptured plaques contained fewer SMCs (Figure 3C).

miR-210 Mimics Prevent Carotid Plaque Rupture In Vivo

To investigate the association between fibrous cap miR-210 expression, SMC survival, and clinically meaningful lesion vulnerability, we used the mouse plaque rupture model to investigate whether miR-210 modulation can influence plaque stability and rupture rate. FAM-labeled oligonucleotides delivered intraperitoneally were successfully incorporated into the carotid arteries (Figure 4A). miR-210 inhibition using locked nucleic acid–modified anti–miR-210 antisense oligonucleotides did not significantly increase rupture rate when compared with similarly delivered negative control (scrambled oligonucleotides, Figure 4B). However, miR-210 overexpression using polyethyleneimine delivered (Jet-PEI, Polyplus-Transfection) miR-210 mimics substantially decreased the rupture rate when compared when Jet-PEI-delivered scrambled control and untreated animals (Figure 4B).

Figure 4.

Figure 4. miR-210 mimics prevent murine carotid plaque rupture.A, FAM (carboxyfluorescein)-labeled miRNA modulators were detected in the tunica media of carotid arteries where plaque rupture was induced. B, Intravenous administration of miR-210 mimics significantly reduces mouse carotid plaque rupture compared with scrambled microRNA (miRNA) and anti–miR-210 plaque rupture rate. Difference in rupture rates analyzed by χ2 test. **P<0.01, *P<0.05. n=48 (control); n=22 (scrambled, of which n=14 locked nucleic acid [LNA] control and n=11 mimic scrambled control carried by Jet-PEI); n=18 (anti–miR-210); and n=20 (miR-210 mimic). C, Carotid arterial α-smooth muscle actin (α-SMA) mRNA (Acta2) was increased in miR-210 mimic vs scrambled-treated mice. Mean+SEM. *P<0.05 in 1-way ANOVA vs scrambled control. D, Immunohistochemical staining for APC (adenomatous polyposis coli) protein and Terminal deoxynucleotidyl transferase dUTP (deoxyuridine triphosphate) nick-end labeling (TUNEL) staining for apoptosis in the mouse model showed significantly lower APC and higher α-SMA expression and a decrease in apoptotic smooth muscle cells (SMCs; TUNEL), in carotid plaque from mice treated with miR-210 mimics vs scrambled-treated mice. Bars: 100 μm. Mean+SEM. **P<0.01, ***P<0.001, ****P<0.0001 vs scrambled. FC indicates fibrous cap; HPF, high-power field; NC, necrotic core; T, thrombus; scr, scrambled control; and untreated, left (uninjured) carotid artery.

α–smooth muscle actin (Acta2) mRNA was increased in carotid artery tissue from mice treated with miR-210 mimics when compared with scrambled and anti–miR-210–treated mice (Figure 4C), suggesting that miR-210 exerts its plaque stabilizing effect by increasing plaque SMC content.

Administration of anti–miR-210 in mice significantly increased Apc mRNA in carotid artery lesions (Online Figure IIID). In mice receiving miR-210 mimics, Apc was not measurably downregulated (Online Figure IIID), likely because of the fact that the mRNA was not fully degraded by miR-210 binding, but instead rendered inactive via cleaving and thus still detectable with qRT-PCR. Of importance, APC was suppressed on the protein level in carotid artery lesions as shown and quantified by carotid immunohistochemical staining (Figure 4D), as well as in liver tissue indicated by Western blotting (Online Figure IIIE). Inversely, administration of anti–miR-210 increased the amount of APC-positive cells in destabilized atherosclerotic plaques when compared with scrambled control and miR-210 mimics (Figure 4D). In addition, miR-210 overexpression significantly blocked the SMC apoptosis rate in murine fibrous caps (Figure 4D). ISH for miR-210 in mice treated with miR-210 mimics or anti–miR-210 was consistent with the modulation (Online Figure IIIF). Administration of miR-210 mimics or anti–miR-210 did not alter lesion B and T-cell influx (Online Figure IIIF). Similar to miR-210 overexpression, knockdown of Apc with in vivo antisense oligonucleotides (GapmeRs) increased carotid Acta2 expression and plaque SMC content in the ligation/cast placement model (Online Figure IVA through IVC; Methods in the Online Data Supplement).

In an atherosclerosis development model using 12-week-old Apoe−/− mice receiving chronic miR-210 modulation, but without any surgical intervention, miR-210 inhibition nor stimulation affected plasma cholesterol (high-density lipoprotein and low-density lipoprotein) and triglyceride levels (Online Figure VA)—or atherosclerosis development per se as assessed by aortic arch en face Sudan IV and aortic root Oil Red O staining (Online Figure VB through VE). Aortic root plaque T cell, α–smooth muscle actin, and macrophage content also remained unchanged (Online Figure VF).

miR-210 Prevents SMC Apoptosis Through Targeting of APC In Vitro

In pathological conditions such as atherosclerosis, the vascular endothelial cell layer becomes insufficient in covering the proliferating SMCs.35 Different types of fluid shear stress can evoke a variety of reactions in these cells, including perpetuating the process of fibrous cap instability.36 Focusing on human carotid artery SMCs (HCtASMCs), considered essential for stabilization of the fibrous cap,1 we used an isolated system that subjected them to physiological (laminar) or pathological (oscillatory) fluidic flow (Online Figure VIA). When HCtASMCs and human carotid artery endothelial cells were exposed to shear stress of 12 dyn/cm2 for 24 hours, oscillatory shear stress caused a loss of miR-210 expression in HCtASMCs, but not in endothelial cells (Figure 5A).

Figure 5.

Figure 5. miR-210 modulation affects APC (adenomatous polyposis coli) expression in vitro.A, Oscillatory (osc, pathological) shear stress results in downregulation of miR-210 in human carotid artery smooth muscle cells (SMC) when compared with laminar (lam, physiological) shear stress. miR-210 expression remains unchanged in response to shear stress alteration in human carotid artery endothelial cells (ECs). Mean+SEM. *P<0.05 in 1-way ANOVA vs static control. n=6 in each group. B, In oscillatory shear stress conditions, APC is significantly upregulated concordant with miR-210 downregulation. Mean+SEM. *P<0.05 in Student t test of oscillatory vs laminar. n=6 in each group. C, 48 h of starvation caused similar miR-210 downregulation and APC upregulation in human carotid artery smooth muscle cells (HCtASMCs). Mean+SEM. ****P<0.0001; *P<0.05 in Student t test of starved vs nonstarved cells. n=3 to 6 in each group. D, Blockade of p53 by its antagonist pifithrin-α increased miR-210 and decreased APC in cells starved for 48 h. Mean+SEM. *P<0.05, **P<0.01 in Student t test of pifithrin- vs vehicle-treated cells. E, Western blot indicates a decrease in APC expression in miR-210 mimic treated HCtASMCs. Representative blots are shown. For densitometric analysis, n=3 in each group. F, Representative images of HCtASMC apoptosis visualized by Terminal deoxynucleotidyl transferase dUTP (deoxyuridine triphosphate) nick-end labeling (TUNEL) staining. Bars: 100 μm. G, Quantification of TUNEL staining results showing that transfection with premiR-210 inhibits HCtASMC apoptosis. Anti–miR-210 does not significantly increase HCtASMC apoptosis. Mean+SEM. ***P<0.001 in 1-way ANOVA of fluorescent TUNEL staining intensity when compared with scrambled control. n=6 randomly chosen high-power fields in each group. SI indicates signal intensity.

In oscillatory versus laminar conditions, APC mRNA was upregulated (Figure 5B). Serum starvation of HCtASMCs caused a significant miR-210 downregulation concomitant with APC induction (Figure 5C). The tumor suppressor p53 has previously been identified as an upstream regulator of miR-210 under hypoxia.29 In starved HCtASMCs, inhibition of p53 with its specific antagonist pifithrin-α prevented miR-210 downregulation (Figure 5D). Oscillatory and laminar flow did not cause significant changes in HCtASMC miR-210 release into the supernatant (Online Figure VIB). Flow did cause a slight upregulation of cellular Wnt signaling, as measured by TCF/LEF transcription in HCtASMCs when compared with static conditions (Online Figure VIC).

Successful in vitro miR-210 overexpression and inhibition was confirmed by qRT-PCR (Online Figure VID). miR-210 overexpression significantly decreases APC protein levels in HCtASMCs (Figure 5E; Online Figure VIA) but does not impede mRNA expression (Online Figure VIE) or HCtASMC proliferation in vitro (Online Figure VIF). However, because APC is a tumor suppressor gene associated with programmed cell death, we used a TUNEL assay to further evaluate whether miR-210 has an antisurvival effect on HCtASMCs. After confirming successful miRNA transfection in vitro (Online Figure VIG), we modulated miR-210 to assess its cellular effects, showing that transfection with premiR-210 significantly inhibited HCtASMC apoptosis (Figure 5F and 5G).

To strengthen the rationale that miR-210 reduces SMC apoptosis via inhibition of APC, modulation of miR-210 and APC siRNA knockdown was evaluated. miR-210 overexpression and APC silencing reduced APC protein expression as indicated with immunofluorescence staining (Online Figure VIIA) and consequentially suppressed cell apoptosis (Figure 6A and 6B) after stimulation with etoposide.

Figure 6.

Figure 6. APC (adenomatous polyposis coli) knockdown in vitro inhibits human carotid artery smooth muscle cell (HCtASMC) apoptosis and stimulates nuclear β-catenin localization.A, siRNA knockdown of APC leads to a reduced HCtASMC apoptosis rate, as quantified by (B), number of Caspase-3–positive cells when compared with cell total. Treating the cells with the apoptosis-inducer etoposide increases this effect. Mean+SEM. ***P<0.001; ****P<0.0001 in Student t test. C, APC knockdown and miR-210 mimics stimulated nuclear β-catenin localization, as quantified by (D), number of β-catenin–positive cells when compared with cell total. Mean+SEM. ***P<0.001; ****P<0.0001 in 1-way ANOVA comparing proportions of positive cells vs scrambled. E, miR-210 inhibition (anti-210) and overexpression (210 mimic) have opposing effects on T-cell factor/lymphoid enhancer factor (TCF/LEF) transcription factor activity. scr indicates scrambled control; and SI, signal intensity.

In canonical Wnt signaling, APC is part of a destruction complex preventing β-catenin from entering the nucleus, a translocation necessary to coactivate proliferative transcription factors, including the TCF/LEF family.37APC siRNA knockdown and miR-210 mimics in HCtASMCs evoked nuclear localization of β-catenin (Figure 6C and 6D). In HEK293 cells, anti–miR-210 and miR-210 mimics had opposing effects on TCF/LEF-dependent signaling, with overexpression of miR-210 resulting in a substantial increase of signaling activity (Figure 6E). However, less pronounced than in HEK293 cells, miR-210 mimics stimulated TCF/LEF signaling in HCtASMCs, an effect abolished by APC overexpression (Online Figure VIIC and VIID). Taken together, our in vitro findings strengthen the hypothesis that miR-210 is a crucial regulator of advanced atherosclerotic lesion fate by stimulating canonical Wnt signaling via inhibition of APC in SMCs as schematically illustrated in Figure 7.

Figure 7.

Figure 7. Descriptive cartoon of the proposed mechanism. Descriptive cartoon of the proposed mechanism of miR-210–dependent inhibition of APC (adenomatous polyposis coli)-mediated apoptosis. TCF/LEF indicates T-cell factor/lymphoid enhancer factor.

Discussion

Today’s clinical debate in carotid atherosclerotic disease as a cause of stroke is focused around the identification of the vulnerable patient and the prevention of plaque rupture. Novel imaging modalities provide increasing levels of sensitivity and specificity38,39 in determining plaque vulnerability. The implementation of this knowledge in clinical practice is however obstructed by the relatively high operational risk of present-day treatment options (CEA and carotid artery stenting) for asymptomatic individuals with carotid stenosis. A less invasive plaque sealing method, based on local (eg, ultrasound mediated40) delivery of fibrous cap stabilizing agents acting on a cellular level, might provide a more refined treatment choice.

The rise of miRNAs as endogenous disease biomarkers and modulators has caused an enormous interest in experimentally measuring and therapeutically manipulating their expression. The particular sensitivity of the human cardiovascular system to subtle gene expression alterations might be an ideal target for miRNAs as they fine tune biological processes.41 By exploiting locally sampled plasma and fibrous cap tissue, we identified miR-210 as the main miRNA being synthetized and released into the local cellular milieu by cells in the fibrous cap of carotid plaques, with unstable plaques releasing only limited amounts of miR-210.

Although we did not observe severe off-target effects of miR-210 mimics, such as cardiac remodeling or kidney fibrosis, reports linking miR-210 with various forms of cancer suggest that miR-210 treatment needs to be applied with caution. Induced under hypoxic conditions28 and targeting tumor suppressor genes,42 miR-210 overexpression is classically associated with cancer. Elevated miR-210 expression levels have been linked to a higher prevalence and a poor prognosis in breast, head, and neck, as well as pancreatic cancer, partly because of a diminished response to therapy.43 If a plaque stabilizing miR-210 therapy is to be considered, potentially tumorigenic off-target effects should be taken into account and prevented—or at least minimized using a local delivery strategy. Local delivery of vascular therapeutic miRNA modulators via coated stents has recently been shown to be safe and highly effective.44

Direct delivery of miR-210 attenuates cardiac injury in mice and has been suggested as a therapeutic agent in ischemic heart disease.45 Results from our study indicate that not only hypoxia, but also other stimuli, including pathological shear stress and altered blood flow conditions, as well as conditions inducing apoptosis and dedifferentiation, can lead to miR-210 repression in the vasculature, resulting in a downstream induction of proapoptotic mechanisms mainly in SMCs. Apoptosis of these cells in the fibrous cap of an atherosclerotic plaque is an important step toward the vulnerable phenotype.1,46 Furthermore, atherogenic wall shear stress, also referred to as disturbed or turbulent, is known to strongly trigger (maladaptive) changes in vascular cell subtypes,47 which in our study was attributed to loss of miR-210.

Among validated miR-210 targets, APC is an important rate-limiting component in canonical Wnt signaling, making it one of the most infamous tumor suppressor genes; loss-of-function mutations are well known to cause colon cancer.37 Wnt signaling in SMCs regulates a variety of atherosclerotic processes, such as proliferation, migration, differentiation, and apoptosis, all crucially involved in plaque stability.30 Stimulation of the Wnt-β-catenin axis leads to an increased SMC survival, whereas a reduction in β-catenin downstream signaling increases SMC apoptosis rates.31 We confirmed this by showing that APC, β-catenin, and TCF/LEF modulation by miR-210 directly regulates SMC apoptosis (Figure 7).

After acute balloon–induced carotid artery injury in rats, miR-210 downregulation and concordant Apc upregulation correlated with arterial remodeling. In induced mouse carotid plaque rupture, closely resembling the human disease with respect to plaque miR-210 expression (Figure 3C), APC protein levels correlated with advanced plaque instability (Figure 4D). By modulating miR-210 expression in vivo, we were able to re-establish miR-210 in carotid arteries, evoking a protective response in lesion site SMCs through inhibition of Apc. Salvaged from apoptosis, these cells stabilized the fibrous cap, resulting in substantially less plaque ruptures. Interestingly, miR-210 modulation solely enhanced fibrous cap stability by triggering SMC survival, while not affecting atherosclerosis development and progression in general.

Because of the immense complexity of miRNA influence on different signaling pathways, caution is required when presenting miRNA modulation as the ultimate solution to vascular pathologies. Off-target effects, pharmacokinetics and dynamics, and metabolic consequences need to be addressed. In this study, we have combined molecular and biophysical basics with in vivo applied miRNA modulation, taking human subjects as a starting point. This approach is essential in making vascular miRNA modulation a near-future therapeutic option, instead of a remote possibility. Local delivery of miR-210 mimics, using drug-eluting balloons/stents or ultrasound-triggered nanodelivery technology, would certainly enhance the translational feasibility of establishing miR-210 induction into clinically relevant plaque sealing approaches in patients with unstable carotid artery disease and enhanced risk of ischemic stroke.

Nonstandard Abbreviations and Acronyms

ACST

Asymptomatic Carotid Surgery Trial

APC

adenomatous polyposis coli

Apoe−/−

apolipoprotein E knockout

BiKE

Biobank of Karolinska Endarterectomies

BS

binding site

CEA

carotid endarterectomy

HCtASMC

human carotid artery smooth muscle cell

ISH

in situ hybridization

LCM

laser capture microdissection

miRNA

microRNA

NASCET

North American Symptomatic Carotid Endarterectomy Trial

qRT-PCR

quantitative reverse transcriptase-polymerase chain reaction

SMC

smooth muscle cell

TCF/LEF

T-cell factor/lymphoid enhancer factor

TUNEL

terminal deoxynucleotidyl transferase dUTP nick-end labeling

UTR

untranslated region

Footnotes

In October 2016, the average time from submission to first decision for all original research papers submitted to Circulation Research was 15.7 days

The online-only Data Supplement is available with this article at http://circres.ahajournals.org/lookup/suppl/doi:10.1161/CIRCRESAHA.116.309318/-/DC1.

Correspondence to Lars Maegdefessel, MD, PhD, Department of Vascular and Endovascular Surgery, Technical University Munich, 81765 Munich, Germany. E-mail

References

  • 1. Libby P, Ridker PM, Hansson GK.Progress and challenges in translating the biology of atherosclerosis.Nature. 2011; 473:317–325. doi: 10.1038/nature10146.CrossrefMedlineGoogle Scholar
  • 2. Donnan GA, Fisher M, Macleod M, Davis SM.Stroke.Lancet. 2008; 371:1612–1623. doi: 10.1016/S0140-6736(08)60694-7.CrossrefMedlineGoogle Scholar
  • 3. Rerkasem K, Rothwell PM.Carotid endarterectomy for symptomatic carotid stenosis.Cochrane Database Syst Rev. 2011; 4:CD001081.Google Scholar
  • 4. Barnett HJ, Taylor DW, Eliasziw M, Fox AJ, Ferguson GG, Haynes RB, Rankin RN, Clagett GP, Hachinski VC, Sackett DL, Thorpe KE, Meldrum HE, Spence JD.Benefit of carotid endarterectomy in patients with symptomatic moderate or severe stenosis. North American Symptomatic Carotid Endarterectomy Trial Collaborators.N Engl J Med. 1998; 339:1415–1425. doi: 10.1056/NEJM199811123392002.CrossrefMedlineGoogle Scholar
  • 5. Brott TG, Hobson RW, Howard G, et al; CREST Investigators. Stenting versus endarterectomy for treatment of carotid-artery stenosis.N Engl J Med. 2010; 363:11–23. doi: 10.1056/NEJMoa0912321.CrossrefMedlineGoogle Scholar
  • 6. Graebe M, Pedersen SF, Højgaard L, Kjaer A, Sillesen H.18FDG PET and ultrasound echolucency in carotid artery plaques.JACC Cardiovasc Imaging. 2010; 3:289–295. doi: 10.1016/j.jcmg.2010.01.001.CrossrefMedlineGoogle Scholar
  • 7. Halliday A, Harrison M, Hayter E, Kong X, Mansfield A, Marro J, Pan H, Peto R, Potter J, Rahimi K, Rau A, Robertson S, Streifler J, Thomas D; Asymptomatic Carotid Surgery Trial (ACST) Collaborative Group. 10-year stroke prevention after successful carotid endarterectomy for asymptomatic stenosis (ACST-1): a multicentre randomised trial.Lancet. 2010; 376:1074–1084. doi: 10.1016/S0140-6736(10)61197-X.CrossrefMedlineGoogle Scholar
  • 8. Kakisis JD, Avgerinos ED, Antonopoulos CN, Giannakopoulos TG, Moulakakis K, Liapis CD.The European Society for Vascular Surgery guidelines for carotid intervention: an updated independent assessment and literature review.Eur J Vasc Endovasc Surg. 2012; 44:238–243. doi: 10.1016/j.ejvs.2012.04.015.CrossrefMedlineGoogle Scholar
  • 9. Lee RC, Feinbaum RL, Ambros V.The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14.Cell. 1993; 75:843–854.CrossrefMedlineGoogle Scholar
  • 10. Friedman RC, Farh KK, Burge CB, Bartel DP.Most mammalian mRNAs are conserved targets of microRNAs.Genome Res. 2009; 19:92–105. doi: 10.1101/gr.082701.108.CrossrefMedlineGoogle Scholar
  • 11. Janssen HL, Reesink HW, Lawitz EJ, Zeuzem S, Rodriguez-Torres M, Patel K, van der Meer AJ, Patick AK, Chen A, Zhou Y, Persson R, King BD, Kauppinen S, Levin AA, Hodges MR.Treatment of HCV infection by targeting microRNA.N Engl J Med. 2013; 368:1685–1694. doi: 10.1056/NEJMoa1209026.CrossrefMedlineGoogle Scholar
  • 12. Loyer X, Vion AC, Tedgui A, Boulanger CM.Microvesicles as cell-cell messengers in cardiovascular diseases.Circ Res. 2014; 114:345–353. doi: 10.1161/CIRCRESAHA.113.300858.LinkGoogle Scholar
  • 13. Kinet V, Halkein J, Dirkx E, Windt LJ.Cardiovascular extracellular microRNAs: emerging diagnostic markers and mechanisms of cell-to-cell RNA communication.Front Genet. 2013; 4:214. doi: 10.3389/fgene.2013.00214.CrossrefMedlineGoogle Scholar
  • 14. Perisic L, Aldi S, Sun Y, Folkersen L, Razuvaev A, Roy J, Lengquist M, Åkesson S, Wheelock CE, Maegdefessel L, Gabrielsen A, Odeberg J, Hansson GK, Paulsson-Berne G, Hedin U.Gene expression signatures, pathways and networks in carotid atherosclerosis.J Intern Med. 2016; 279:293–308. doi: 10.1111/joim.12448.CrossrefMedlineGoogle Scholar
  • 15. Stary HC, Chandler AB, Dinsmore RE, Fuster V, Glagov S, Insull W, Rosenfeld ME, Schwartz CJ, Wagner WD, Wissler RW.A definition of advanced types of atherosclerotic lesions and a histological classification of atherosclerosis. A report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association.Circulation. 1995; 92:1355–1374.LinkGoogle Scholar
  • 16. Redgrave JN, Gallagher P, Lovett JK, Rothwell PM.Critical cap thickness and rupture in symptomatic carotid plaques: the oxford plaque study.Stroke. 2008; 39:1722–1729. doi: 10.1161/STROKEAHA.107.507988.LinkGoogle Scholar
  • 17. Hsu SD, Lin FM, Wu WY, Liang C, Huang WC, Chan WL, Tsai WT, Chen GZ, Lee CJ, Chiu CM, Chien CH, Wu MC, Huang CY, Tsou AP, Huang HD.miRTarBase: a database curates experimentally validated microRNA-target interactions.Nucleic Acids Res. 2011; 39:D163–D169. doi: 10.1093/nar/gkq1107.CrossrefMedlineGoogle Scholar
  • 18. Miranda KC, Huynh T, Tay Y, Ang YS, Tam WL, Thomson AM, Lim B, Rigoutsos I.A pattern-based method for the identification of MicroRNA binding sites and their corresponding heteroduplexes.Cell. 2006; 126:1203–1217. doi: 10.1016/j.cell.2006.07.031.CrossrefMedlineGoogle Scholar
  • 19. Li Y, Challagundla KB, Sun XX, Zhang Q, Dai MS.MicroRNA-130a associates with ribosomal protein L11 to suppress c-Myc expression in response to UV irradiation.Oncotarget. 2015; 6:1101–1114. doi: 10.18632/oncotarget.2728.CrossrefMedlineGoogle Scholar
  • 20. Razuvaev A, Lund K, Roy J, Hedin U, Caidahl K.Noninvasive real-time imaging of intima thickness after rat carotid artery balloon injury using ultrasound biomicroscopy.Atherosclerosis. 2008; 199:310–316. doi: 10.1016/j.atherosclerosis.2007.11.035.CrossrefMedlineGoogle Scholar
  • 21. Sasaki T, Kuzuya M, Nakamura K, Cheng XW, Shibata T, Sato K, Iguchi A.A simple method of plaque rupture induction in apolipoprotein E-deficient mice.Arterioscler Thromb Vasc Biol. 2006; 26:1304–1309. doi: 10.1161/01.ATV.0000219687.71607.f7.LinkGoogle Scholar
  • 22. Larsson M, Rayzman V, Nolte MW, et al. A factor XIIa inhibitory antibody provides thromboprotection in extracorporeal circulation without increasing bleeding risk.Sci Transl Med. 2014; 6:222ra17. doi: 10.1126/scitranslmed.3006804.CrossrefMedlineGoogle Scholar
  • 23. Schneikert J, Behrens J.Truncated APC is required for cell proliferation and DNA replication.Int J Cancer. 2006; 119:74–79. doi: 10.1002/ijc.21826.CrossrefMedlineGoogle Scholar
  • 24. Weber M, Baker MB, Moore JP, Searles CD.MiR-21 is induced in endothelial cells by shear stress and modulates apoptosis and eNOS activity.Biochem Biophys Res Commun. 2010; 393:643–648. doi: 10.1016/j.bbrc.2010.02.045.CrossrefMedlineGoogle Scholar
  • 25. van Rooij E, Sutherland LB, Thatcher JE, DiMaio JM, Naseem RH, Marshall WS, Hill JA, Olson EN.Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis.Proc Natl Acad Sci USA. 2008; 105:13027–13032. doi: 10.1073/pnas.0805038105.CrossrefMedlineGoogle Scholar
  • 26. Schober A, Nazari-Jahantigh M, Wei Y, Bidzhekov K, Gremse F, Grommes J, Megens RT, Heyll K, Noels H, Hristov M, Wang S, Kiessling F, Olson EN, Weber C.MicroRNA-126-5p promotes endothelial proliferation and limits atherosclerosis by suppressing Dlk1.Nat Med. 2014; 20:368–376. doi: 10.1038/nm.3487.CrossrefMedlineGoogle Scholar
  • 27. Albinsson S, Suarez Y, Skoura A, Offermanns S, Miano JM, Sessa WC.MicroRNAs are necessary for vascular smooth muscle growth, differentiation, and function.Arterioscler Thromb Vasc Biol. 2010; 30:1118–1126. doi: 10.1161/ATVBAHA.109.200873.LinkGoogle Scholar
  • 28. Fasanaro P, Greco S, Lorenzi M, Pescatori M, Brioschi M, Kulshreshtha R, Banfi C, Stubbs A, Calin GA, Ivan M, Capogrossi MC, Martelli F.An integrated approach for experimental target identification of hypoxia-induced miR-210.J Biol Chem. 2009; 284:35134–35143. doi: 10.1074/jbc.M109.052779.CrossrefMedlineGoogle Scholar
  • 29. Mutharasan RK, Nagpal V, Ichikawa Y, Ardehali H.microRNA-210 is upregulated in hypoxic cardiomyocytes through Akt- and p53-dependent pathways and exerts cytoprotective effects.Am J Physiol Heart Circ Physiol. 2011; 301:H1519–H1530. doi: 10.1152/ajpheart.01080.2010.CrossrefMedlineGoogle Scholar
  • 30. Mill C, George SJ.Wnt signalling in smooth muscle cells and its role in cardiovascular disorders.Cardiovasc Res. 2012; 95:233–240. doi: 10.1093/cvr/cvs141.CrossrefMedlineGoogle Scholar
  • 31. Lv L, Zhou Z, Huang X, Zhao Y, Zhang L, Shi Y, Sun M, Zhang J.Inhibition of peptidyl-prolyl cis/trans isomerase Pin1 induces cell cycle arrest and apoptosis in vascular smooth muscle cells.Apoptosis. 2010; 15:41–54. doi: 10.1007/s10495-009-0409-8.CrossrefMedlineGoogle Scholar
  • 32. Noman MZ, Buart S, Romero P, Ketari S, Janji B, Mari B, Mami-Chouaib F, Chouaib S.Hypoxia-inducible miR-210 regulates the susceptibility of tumor cells to lysis by cytotoxic T cells.Cancer Res. 2012; 72:4629–4641. doi: 10.1158/0008-5472.CAN-12-1383.CrossrefMedlineGoogle Scholar
  • 33. Chan SY, Zhang YY, Hemann C, Mahoney CE, Zweier JL, Loscalzo J.MicroRNA-210 controls mitochondrial metabolism during hypoxia by repressing the iron-sulfur cluster assembly proteins ISCU1/2.Cell Metab. 2009; 10:273–284. doi: 10.1016/j.cmet.2009.08.015.CrossrefMedlineGoogle Scholar
  • 34. Hoffman Y, Bublik DR, Ugalde AP, Elkon R, Biniashvili T, Agami R, Oren M, Pilpel Y.3’UTR shortening potentiates microRNA-based repression of pro-differentiation genes in proliferating human cells.PLoS Genet. 2016; 12:e1005879. doi: 10.1371/journal.pgen.1005879.CrossrefMedlineGoogle Scholar
  • 35. Shi ZD, Tarbell JM.Fluid flow mechanotransduction in vascular smooth muscle cells and fibroblasts.Ann Biomed Eng. 2011; 39:1608–1619. doi: 10.1007/s10439-011-0309-2.CrossrefMedlineGoogle Scholar
  • 36. Ekstrand J, Razuvaev A, Folkersen L, Roy J, Hedin U.Tissue factor pathway inhibitor-2 is induced by fluid shear stress in vascular smooth muscle cells and affects cell proliferation and survival.J Vasc Surg. 2010; 52:167–175. doi: 10.1016/j.jvs.2010.02.282.CrossrefMedlineGoogle Scholar
  • 37. Markowitz SD, Bertagnolli MM.Molecular origins of cancer: molecular basis of colorectal cancer.N Engl J Med. 2009; 361:2449–2460. doi: 10.1056/NEJMra0804588.CrossrefMedlineGoogle Scholar
  • 38. Takaya N, Yuan C, Chu B, Saam T, Underhill H, Cai J, Tran N, Polissar NL, Isaac C, Ferguson MS, Garden GA, Cramer SC, Maravilla KR, Hashimoto B, Hatsukami TS.Association between carotid plaque characteristics and subsequent ischemic cerebrovascular events: a prospective assessment with MRI–initial results.Stroke. 2006; 37:818–823. doi: 10.1161/01.STR.0000204638.91099.91.LinkGoogle Scholar
  • 39. Fleg JL, Stone GW, Fayad ZA, Granada JF, Hatsukami TS, Kolodgie FD, Ohayon J, Pettigrew R, Sabatine MS, Tearney GJ, Waxman S, Domanski MJ, Srinivas PR, Narula J.Detection of high-risk atherosclerotic plaque: report of the NHLBI Working Group on current status and future directions.JACC Cardiovasc Imaging. 2012; 5:941–955. doi: 10.1016/j.jcmg.2012.07.007.CrossrefMedlineGoogle Scholar
  • 40. Kwekkeboom RF, Sluijter JP, van Middelaar BJ, Metz CH, Brans MA, Kamp O, Paulus WJ, Musters RJ.Increased local delivery of antagomir therapeutics to the rodent myocardium using ultrasound and microbubbles.J Control Release. 2016; 222:18–31. doi: 10.1016/j.jconrel.2015.11.020.CrossrefMedlineGoogle Scholar
  • 41. Small EM, Olson EN.Pervasive roles of microRNAs in cardiovascular biology.Nature. 2011; 469:336–342. doi: 10.1038/nature09783.CrossrefMedlineGoogle Scholar
  • 42. Grosso S, Doyen J, Parks SK, Bertero T, Paye A, Cardinaud B, Gounon P, Lacas-Gervais S, Noël A, Pouysségur J, Barbry P, Mazure NM, Mari B.MiR-210 promotes a hypoxic phenotype and increases radioresistance in human lung cancer cell lines.Cell Death Dis. 2013; 4:e544. doi: 10.1038/cddis.2013.71.CrossrefMedlineGoogle Scholar
  • 43. Qin Q, Furong W, Baosheng L.Multiple functions of hypoxia-regulated miR-210 in cancer.J Exp Clin Cancer Res. 2014; 33:50. doi: 10.1186/1756-9966-33-50.CrossrefMedlineGoogle Scholar
  • 44. Wang D, Deuse T, Stubbendorff M, et al. Local microRNA modulation using a novel anti-miR-21-eluting stent effectively prevents experimental in-stent restenosis.Arterioscler Thromb Vasc Biol. 2015; 35:1945–1953. doi: 10.1161/ATVBAHA.115.305597.LinkGoogle Scholar
  • 45. Hu S, Huang M, Li Z, Jia F, Ghosh Z, Lijkwan MA, Fasanaro P, Sun N, Wang X, Martelli F, Robbins RC, Wu JC.MicroRNA-210 as a novel therapy for treatment of ischemic heart disease.Circulation. 2010; 122:S124–S131. doi: 10.1161/CIRCULATIONAHA.109.928424.LinkGoogle Scholar
  • 46. Slager CJ, Wentzel JJ, Gijsen FJ, Thury A, van der Wal AC, Schaar JA, Serruys PW.The role of shear stress in the destabilization of vulnerable plaques and related therapeutic implications.Nat Clin Pract Cardiovasc Med. 2005; 2:456–464. doi: 10.1038/ncpcardio0298.CrossrefMedlineGoogle Scholar
  • 47. Conway DE, Schwartz MA.Flow-dependent cellular mechanotransduction in atherosclerosis.J Cell Sci. 2013; 126:5101–5109. doi: 10.1242/jcs.138313.CrossrefMedlineGoogle Scholar

Novelty and Significance

What Is Known?

  • In cardiovascular disease, rupture of the fibrous cap of an atherosclerotic plaque typically marks the onset of clinical symptoms.

  • Local factors regulating proliferation and apoptosis of smooth muscle cells (SMCs) in the vessel wall contribute to the stability of the atherosclerotic fibrous cap.

  • MicroRNAs (miRNAs) are potent regulators of gene expression and can be modified to alter cellular responses to pathological stress.

What New Information Does This Article Contribute?

  • Unstable carotid atherosclerotic fibrous caps are characterized by a decrease in intracellular, as well as locally released, miR-210.

  • miR-210 directly inhibits the tumor suppressor gene APC (adenomatous polyposis coli) in SMCs of the fibrous cap, thereby stimulating Wnt (Wingless-related integration site) signaling, thus increasing SMC proliferation and survival.

  • Systemic miR-210 overexpression can increase the stability of the fibrous cap of carotid atherosclerotic lesions in mice.

Cardiovascular disease is characterized by a clinically silent state of atherosclerotic plaque development. Symptoms occur when these plaques rupture and cause thrombotic occlusions downstream of the lesion, an example being the relation between carotid stenosis and stroke. Current treatment is focused on identification and removal of the plaque but is invasive and only feasible in a small number of patients. Stabilization of the fibrous cap, preventing atherosclerotic plaque rupture, could be a noninvasive way to reduce cardiovascular morbidity and mortality. We identified miR-210, as being substantially downregulated in the fibrous cap of unstable carotid atherosclerotic plaques. miR-210 associates with carotid SMCs and, in these cells, inhibits the expression of APC, a tumor suppressor gene involved in limiting Wnt signaling. We found that by blocking APC, miR-210 contributes to proliferation and survival of SMCs and thus stimulates plaque stability. Our findings suggest that overexpression of miR-210 could promote the development of an atheroprotective phenotype in SMCs. Our identification of the role of the miR-210–APC–Wnt signaling axis in atherogenesis suggests that the delivery of miR-210 mimics directed specifically to vulnerable carotid lesions could stabilize the plaque and prevent ischemic stroke.

eLetters(0)

eLetters should relate to an article recently published in the journal and are not a forum for providing unpublished data. Comments are reviewed for appropriate use of tone and language. Comments are not peer-reviewed. Acceptable comments are posted to the journal website only. Comments are not published in an issue and are not indexed in PubMed. Comments should be no longer than 500 words and will only be posted online. References are limited to 10. Authors of the article cited in the comment will be invited to reply, as appropriate.

Comments and feedback on AHA/ASA Scientific Statements and Guidelines should be directed to the AHA/ASA Manuscript Oversight Committee via its Correspondence page.