Introduction

Megakaryocytes invest platelets with a complex transcriptome and requisite translational machinery including ribosomes, initiation and termination factors, microRNAs, and messenger RNAs (mRNAs).^1,2 Platelets use a variety of translational and posttranslational mechanisms to finely regulate their protein profile, although only some of these have been identified. For example, a subset of mRNAs are under the translational control of the mTOR pathway,^3,4 although this is thought to be mainly mRNAs possessing a 5′ terminal oligopyrimidine tract⁵ or a pyrimidine-rich translational element.⁶ An additional translational regulatory pathway in platelets is cytoplasmic, signal-dependent pre-mRNA splicing.^7,8 Nevertheless, only a limited number of pre-mRNAs have been identified in human platelets.^7–9 Therefore, additional translational control mechanisms likely exist in human platelets. Because of the anucleate nature of platelets, they serve as an ideal model system to study translational regulatory mechanisms.

See accompanying editorial on page 690

Because of their ability to insert themselves into various genomic locations, human transposable elements contribute importantly to a highly dynamic genome.¹⁰ The only functional autonomous nonlong terminal repeat retrotransposon in humans is LINE-1 (long interspersed nuclear element-1, L1).¹¹ Almost 17% of the human genome consists of LINE-1 elements.^12,13 Active, full-length L1 elements consist of a 5′ untranslated region with internal promoter activity, 2 ORFs (open reading frames) separated by a short intergenic region, a 3′ untranslated region that ends with an AATAAA polyadenylation signal, and a poly(A) tail.^11,14,15 L1 mRNAs are atypical of mammalian mRNAs because they are bicistronic.¹¹ The 2 human ORFs in L1 elements (ORF1 and ORF2p [ORF2 proteins]) are in frame, separated by a 63-bp noncoding spacer that contains stop codons.¹¹ Translation of ORF1p (ORF1 protein) occurs via ribosomal initiation in the 5′ untranslated region,¹⁶ whereas translation of ORF2p occurs by an unconventional termination/reinitiation mechanism.¹⁷ The COOH-terminal half of the 40-kDa ORF1p (p40) is involved in RNA binding and is well conserved across species.^11,18–20 ORF2 encodes an ≈150-kDa protein with 3 conserved domains: NH₂-terminal endonuclease domain, central reverse transcriptase (RT) domain, and COOH-terminal zinc finger-like domain.^11,21–23 Both L1-encoded proteins preferentially associate with their own encoding RNA (cis preference) to form a ribonucleoprotein particle (RNP) complex,^24,25 a proposed retrotransposition intermediate.^26,27 However, L1-encoded RT is also known to reverse transcribe RNAs encoded by Alu elements,²⁸ SVA elements,²⁹ and Pol II mRNAs causing processed pseudogene formation (26) in trans. L1 RT can reverse transcribe mRNAs coding for actin, GAPDH, and nucleolin into cDNAs.³⁰ In addition to shaping the genome over evolutionary time, L1 retrotransposition events alter gene expression patterns.³¹ The most notable gene altering process involves insertional mutagenesis, which can serve as a functional gene knockout.³² Retrotransposed L1 sequences can also function as alternative promoters that regulate gene transcription.³³ The insertion of L1 sequences into introns considerably reduces transcriptional elongation of target genes.³⁴ L1 retrotransposition events are responsible for diseases including hemophilia, β-thalassemia, and muscular dystrophy.³⁵ There is also evidence that endogenous RT (eRT) activity regulates cellular proliferation, differentiation, and gene expression.^36–41

Reverse transcription of RNA also generates RNA–DNA hybrid intermediates. The formation of RNA–DNA hybrids has been used in molecular biology strategies as an in vitro technique to identify specifically translated mRNAs.^42,43 RNA–DNA hybrids also regulate transcriptional efficiency⁴⁴ and are required for efficient double-strand break repair.⁴⁵

People with HIV are typically prescribed RT inhibitor–based therapy. The introduction of antiretroviral therapy (ART) has resulted in improved life expectancy.⁴⁶ However, people with HIV are at increased risk of thrombotic disorders, including atherothrombosis.^47–49 The molecular mechanisms underpinning this increased thrombosis risk remain unclear. In addition, whether platelets, which promote thrombosis, are directly affected by RT inhibitors has not been studied in detail. Accordingly, we sought to determine if human platelets possess RT activity and, if so, its functional effects.

Materials and Methods

Reagents and Antibodies

The following drugs and reagents were used freshly prepared or from stock solutions: nevirapine (100, 500, or 750 µmol/L in dimethyl sulfoxide [DMSO]; Sigma, St. Louis, MO). The following reagents and antibodies were used for microscopy, Western blot, and co-immunoprecipitation studies described below: paraformaldehyde (4% [2% final]), Alexa Fluor 546 conjugate of wheat germ agglutinin (1:1000; Life Technologies, Eugene, OR), custom rabbit anti-L1 ORF1p antibody #984 (provided by Schumann²⁹), custom rabbit-anti-LINE-1 ORF2p (immunization peptide c+PKPGRDTTKKENFRP, 518–532, protein id AAD39215.1; Eurogentec, Liege, Belgium). This antibody was immunopurified and verified for specificity by Western blot (quench experiment). A rabbit anti-LINE-1 ORF2p and goat anti-P-selectin (Santa Cruz, TX), goat anti-T7, mouse anti-myc-DDK, rabbit anti-LC3B, and rabbit antiribosomal protein L26 (Abcam, Cambridge, MA), mouse anti-DNA–RNA hybrid (Kerafast, Boston, MA), rabbit anti-TAP (Thermo Fisher Scientific, Waltham, MA), Click-IT AHA (l-Azidohomoalanine), and Click-IT AF488 alkyne (1 mmol/L; Life Technologies).

Platelet Isolation and Culture

All studies were approved by the institutional ethics committee (IRB#000392 and IRB#00077138). Platelets used for the described studies were freshly isolated from medication-free, healthy human subjects or, in select studies, from patients with HIV (see below). Platelets were leukocyte reduced and isolated as previously described to yield a highly-purified population of cells with <1 leukocyte per 10× platelets.^7,8,50 Depleted platelets were resuspended at 1×10⁸/mL in serum-free M199 medium, placed in round-bottom polypropylene tubes (Becton Dickinson, Franklin Lakes, NJ), and cultured in a 37°C humidified incubator at 5% CO₂ for different time points. In select studies, platelets were treated with nevirapine or its vehicle control (DMSO).

RT-Activity Assays

RT-activity assays were performed as previously described.³⁷ In brief, platelets (2×10⁹/200 µL) or platelet-derived ribonucleoprotein particles (RNPs; see below for details) were lysed in a buffer containing 10 mmol/L Tris (2-amino-2-(hydroxymethyl)-1,3-propanediol)–HCl pH 7.5, 1 mmol/L MgCl₂, 1 mmol/L EGTA, 0.1 mmol/L PMSF (phenylmethane sulfonyl fluoride), 5 mmol/L β-mercaptoethanol, 0.5% CHAPS, and 10% glycerol. In select experiments, RNP lysates were immunodepleted for L1 ORF2p using the aforementioned anti-L1 ORF2p antibody and Agarose A/G plus beads (Life Technologies). The lysates were incubated on ice and finally centrifuged at 14 000 rpm for 30 minutes to remove any cell debris. In select experiments, the cell lysates were treated with nevirapine or its vehicle control (DMSO) or separated into retentate and filtrate using a 100 kDa spin column (EMD Millipore, Billerica, MA, according to the manufacturer’s protocol). RT activity was tested using the ThermoScript reverse transcriptase polymerase chain reaction (RT-PCR) system (Life Technologies) in 20 µL reactions containing 10 ng of MS2 bacteriophage RNA (Roche Diagnostics, Basel, Swiss) or GFP (green fluorescent protein)-RNA (custom in vitro transcribed), which were treated with DNase, RT-PCR buffer, 5 mmol/L dithiothreitol, 1 mmol/L of 4 nucleotide triphosphate mix, 5 U of RNaseOUT, 15 pmol of MS2 reverse primer and substituting commercial RT with cell-free extract (1.5×10⁷ total cell amount equivalent in each reaction). After the RT reaction, a 2 µL volume of the RT reaction were mixed with MS2 forward and reverse primers (5′-TCCTGCTCAACTTCCTGTCGAG-3′, 5′-CACAGGTCAAACCTCCTAGGAATG-3′), and polymerase chain reaction was performed using the ThermoScript RT-PCR kit (Life Technologies). To exclude non-specific amplification reaction or contamination we included a panel of positive and negative control reactions as previously described.³⁷ In vitro assays of RT inhibition were performed in the same mixtures as used for the RT activity assay except that the extracts were pre-incubated with various doses of non-nucleoside reverse transcriptase inhibitors (NNRTI) prior to adding the MS2 RNA template.

RNA Isolation

Platelets were lysed in TRIZOL, and RNA isolation was performed a previously described.^7,8

Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Studies

To determine LINE-1 mRNA expression pattern in human platelets, primers flanking ORF1 (5′-agaaatgagcaaagcctcca-3′ and 5′-GCCTGGTGGTGACAAAATCT-3′) and ORF2 (5′-tccagcagcacatcaaaaag-3′ and 5′-CCAGTTTTTGCCCATTCAGT-3′) were used (Figure 1C), and PCR was performed. PCR products were excised and subjected to Sanger Sequencing using standard methods. MAP1LC3B mRNA expression was detected by PCR and quantitative PCR (iCycler; BioRad, Hercules, CA) using the following primer set: 5′-GAAGTGGCTATCGCCAGAGT-3′ and 5′-GATTTTGGTTGGATGCTGCT-3′. RNA was detected using the following primer set: 5′-ATGGACCTTGGTGAATTGTGTG-3′ and 5′-TGGAAATGTGTCGTTCCTATGG-3′.

Platelet In Situ Hybridization Assays

For the assessment of in situ presence of LINE-1 mRNA and RNA in human platelets, platelets were fixed in suspension and spun down onto vectabond (Vector Laboratories, Burlingame, CA)-coated coverslips as previously described.⁵¹ In situ hybridization was performed using custom-designed and manufactured probes (see schematic Figure 2D) against LINE-1 according to the manufacturer’s algorithms and protocols (Biosearch Technologies, Novato, CA).

Immunocytochemistry

Freshly isolated platelets were fixed in suspension or placed in fibrinogen-coated chamber slides to induce platelet spreading at various times (2, 6, or 18 hours), fixed in paraformaldehyde, and subsequently incubated with IgG or an antibody against LINE-1 ORF1p or ORF2p (see the section on Reagents and Antibodies). In other experiments, platelets were either fixed immediately, to assess baseline RNA–DNA hybrid expression, or allowed to incubate for 18 hours in suspension. At the end of the experimental period, paraformaldehyde was added directly to the platelets to maintain the native morphology of the cells, as previously described.^8,50 Fixed platelets were subsequently layered onto vectabond (Vector Laboratories)-coated coverslips using a cytospin centrifuge (Shandon Cytospin; Thermo Fisher Scientific). Platelets were permeabilized, and RNA–DNA hybrids were specifically detected using the aforementioned antibodies. Specificity of the staining for anti–RNA-DNA hybrids was confirmed with isotype-matched nonimmune IgG. To further confirm the specificity of the staining procedure, we used differential digestion of RNAs (RNase I, RNase A [high NaCl], RNase A [low NaCl], and Turbo DNase, all from Life Technologies).

Protein Expression Studies

All samples were normalized for starting cell concentrations. Platelets or platelet-derived RNPs were lysed in Laemmli buffer, and samples were separated by SDS–PAGE and examined by Western analysis for LINE-1 ORF1p, and ORF2p expression patterns. Subsequently, proteins were detected by enhanced chemiluminescence. In quench experiments, the custom rabbit-anti-LINE-1 ORF2p antibody (see the section on Reagents and Antibodies) was preincubated with its corresponding immunogenic peptide to demonstrate specificity. Additionally, P-selectin, ribosomal protein L26, and MAP1LC3B were detected using the same technique. Quantification of Western blots was performed using ImageJ (National Institutes of Health).

Flow Cytometry

The expression of platelet surface adhesion molecules (eg, PAC-1 binding to activated integrin αIIbβ3) was evaluated by flow cytometry.⁵⁰ Freshly isolated platelets were cultured in the presence of nevirapine 750 µmol/L or its vehicle (DMSO, 6 hours), and subsequently activated with thrombin (0.1 U/mL) for 10 minutes (Figure 4B). For Figure 4E, baseline platelets from healthy individuals and persons positive for HIV were evaluated. The cells were incubated with fluorescein isothiocyanate–conjugated antibody PAC-1 (number: 340535; BD Biosciences), fixed, and analyzed on a 5-color FACScan analyzer (BD Biosciences) with appropriate isotype controls. Samples were analyzed using FlowJo v9 (Flowjo LLC, Ashland, OR).

In Vivo Pulmonary Embolism Model

All animal studies were approved by the University of Utah IACUC (protocol 15-10004). Eight- to 12-week-old male and female mice C57Bl/6 mice were either administered 150 mg/kg nevirapine resuspended in saline with 0.2% methylcellulose or vehicle control (saline with 0.2% methylcellulose) by oral gauge once a day for 4 consecutive days. On the fifth day, mice we subjected to a collagen/epinephrine pulmonary embolism model as previously described.⁵² Cessation of breathing was monitored for 10 minutes before animals were euthanized by CO₂ asphyxiation.

RNP Isolation

RNP isolation was performed according to the study by Kulpa et al.³⁰ In brief, platelets were lysed in RNP lysis buffer (1.5 mmol/L KCl, 2.5 mmol/L MgCl₂, 5 mmol/L Tris–HCl [pH 7.4], 1% [w/v] deoxycholic acid, 1% [v/v] Triton X-100, and 1× Complete Mini EDTA-free protease inhibitor cocktail [Roche Diagnostics]). Cleared supernatant was layered onto a sucrose cushion (8.5% and 17% [w/v] sucrose in 80 mmol/L NaCl, 5 mmol/L MgCl₂, 20 mmol/L Tris–HCl [ph 7.5], 1 mmol/L dithiothreitol, and 1× Complete Mini EDTA-free protease inhibitor cocktail). After a centrifugation step of 178 000g for 2 hours, the resulting pellet was lysed in TRIZOL for RNA isolation or in RT-activity assay buffer to assess for RT activity.

In Vitro Translation of ORF1p and RNA Binding and Immunoprecipitation Studies

We first in vitro translated ORF1p. In brief, a T7 promoter was put in front of the ORF1p coding segment of the pAD2TE plasmid (provided by J.V. Moran⁵³) by using a PCR approach (T7 LINE-1 ORF1 forward 5′- TAATACGACTCACTATAGGGATGGGGAAAAAACAGAACAG -3′, T7 LINE-1 ORF1 reverse 5′- TTAACCCATTTGCTGTCCACCAGTCATGCTAGC -3′). The resulting PCR product was in vitro transcribed using the MEGAscript T7 kit, supplemented with the anti-reverse cap analog, and poly(A)-tailed using a poly(A)-tailing kit (all from Life Technologies). RNA was subsequently isolated and introduced into the 1-step human coupled IVT kit (Thermo Fisher Scientific) according to the manufacturer’s protocol. For all RNA binding and immunoprecipitation (IP; RIP) studies, the Magna RIP RNA-binding protein immunoprecipitation kit (EMD Millipore) was used according to the manufacturer’s protocol. In brief, in vitro translated T7-tagged ORF1p was used in each reaction (specific antibody and the isotype-matched nonimmune IgG). The magnetic beads used for the IP reaction were prepared by incubating the beads with the antibody of interest (goat anti-T7; Abcam) or the respective IgG control for 30 nutes at room temperature. IP was performed using the prepared beads, the supplied buffer, and the in vitro translated T7-tagged ORF1p with constant rotation overnight at 4°C. After several washes, total RNA (1.5 µg/sample) was isolated from platelets, added to the bead-bound protein, and incubated overnight at 4°C under constant rotation. Finally, beads were pelleted, and RNA bound to ORF1p was isolated using TRIZOL according to the manufacturer’s protocol. For cDNA synthesis, the superscript II RT-PCR system (Life Technologies) was used. After the RT reaction, a 2 µL volume of the RT reaction was mixed with ORF2 primer (5′-tccagcagcacatcaaaaag-3′ and 5′-CCAGTTTTTGCCCATTCAGT-3′), or MAP1LC3B primer (5′-GAAGTGGCTATCGCCAGAGT-3′ and 5′-GATTTTGGTTGGATGCTGCT-3′), and PCR was performed.

Analysis of Platelet Morphology

For assessment of extended platelets with ≥2 cell bodies, platelets were isolated and resuspended at 1×10⁸ mL in serum-free M199 medium and cultured in a 37°C humidified incubator at 5% CO₂ for 6 hours in the presence of nevirapine or its vehicle (DMSO). The time course for these experiments was selected based on published studies from our laboratory identifying that 6 hours allows for extended cell body formation ex vivo.⁵⁰ After the incubation period, cells were carefully fixed (paraformaldehyde) and spun on glass coverslips. Random fields (3 for each experimental condition) were recorded using microscopy techniques. Total platelets per field were counted (average 450 cells/field). Extended platelets were defined as platelets clearly possessing an extended morphology and ≥2 distinct cell bodies as previously described by our group and others.^50,54 Changes in the formation of extended platelets were analyzed and compared with vehicle-treated conditions.

Protein De Novo Synthesis Studies

Microscopy-based global protein synthesis studies using Click-IT AHA (l-Azidohomoalanine) were performed as previously described.⁵⁰ For these studies, an average of 1000 platelets per treatment arm were analyzed using CellProfiler software (see below for details). For global protein synthesis studies using radioactively labeled amino acids, purified platelets were resuspended at 1×10⁸/mL in serum-, methionine-, and cysteine-free DMEM (Life Technologies), placed in round-bottom polypropylene tubes (Becton Dickinson), and cultured overnight in a 37°C humidified incubator at 5% CO₂ in the presence of [³⁵S]methionine and [³⁵S]cysteine. In select studies, platelets were treated with nevirapine or vehicle control (DMSO). Two-dimensional gel electrophoresis was performed as previously described.⁵⁰ In brief, platelets were lysed in buffer containing 7 mol/L urea, 2 mol/L thiourea, 4% CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate), 40 mmol/L TRIS (base), and 2 tablets of a protease inhibitor mix per 20 mL of buffer stock solution (complete mini; Roche Diagnostics). Isoelectric focusing was performed using the Protean IEF Cell (BioRad) at a temperature of 20°C. Gel strips (pH 3–10L; GE Healthcare, Marlborough, MA) were rehydrated for 12 hours at 50 V using a buffer containing 7 mol/L urea, 2 mol/L thiourea, 2% CHAPS, 0.5% IPG buffer (pH 3–10L), dithiothreitol (2.8 mg/mL), and traces of bromophenol blue. The samples were applied as part of the rehydration solution, and lysates were run on a 11-cm strip (linear gradient for 2 hours (100 V), linear gradient for 1 hour (500 V), linear gradient for 5 hours (1000 V), linear gradient for 2.5 hours (8000 V), and then a quick ramp and hold for 35 minutes (8000 V). For the second dimension (SDS–PAGE), IPG strips were equilibrated for 20 minutes in buffer (6 mol/L urea, 30% v/v glycerol [87% v/v], 2% w/v SDS, 50 mmol/L Tris–Cl, pH 8.8, 100-mg dithiothreitol/10 mL, and traces of bromophenol blue). Gels (4–20%; Jule, Milford, CT) were coomassie stained using an optimized protocol from Neuhoff et al^55,56 and subsequently dried and exposed to a Biomax MR film (Carestream, Rochester, NY) for autoradiographic detection.

RNA–DNA Hybrid Immunoprecipitation Studies (Modified RIP)

For all modified RIP studies, the Magna RIP RNA-binding protein immunoprecipitation kit (EMD Millipore) was used according to the manufacturer’s protocol. In brief, 24×10⁹ total platelets were first lysed in 200 µL of complete RIP lysis buffer. Next, 12×10⁹ platelets were used in each reaction for the hybrid-specific antibody and the isotype-matched nonimmune IgG. The magnetic beads used for the IP reaction were prepared by incubating the beads with the antibody of interest (anti-RNA–DNA hybrid) or the respective IgG control for 30 minutes at RT. RIP was performed using the prepared beads, the supplied buffer, and 100 µL of the platelet cell lysate with constant rotation for 4 hours at 4°C. Phenol-chloroform isolation techniques were used for RNA purification with an additional overnight ethanol precipitation step. RNA yield was measured using the NanoDrop spectrometer. RNA–DNA hybrids were stored at −80°C until sequencing was performed.

Next-Generation RNA Sequencing

The cDNA libraries for deep sequencing were prepared using random hexamers. Samples were sequenced using the NEBNext Multiples Small RNA library Prep Set kit for 50 cycles as single reads, sequencing version 4, on an HiSeq sequencer, and sequence reads were processed and aligned to hg38 as previously described.^57,58

Translational Block Experiments

The translational block experiments were based on the RT-activity assay described above. In brief, platelets (2×10⁹/200 µL) were lysed in the RT buffer. The platelet lysate was preincubated with nevirapine (500 µmol/L for 45 minutes at 37°C) with and without a melting step (2 minutes at 95°C) to separate RNA–DNA hybrids. The RT activity assay was set up in 20 µL reactions containing 70.8 ng of MAP1LC3B in vitro–transcribed mRNA (True ORF RC207356; Origene, Rockville, MD; mMESSAGE mMACHINE T7 Ultra Kit, Life Technologies), which was DNase treated. After the RT reaction, the resulting nucleic acids were introduced into an in vitro translation assay (1-step human coupled IVT kit; ThermoFisher Scientific, Waltham, MA). The resulting myc-DDK tagged MAP1LC3B protein was separated by SDS–PAGE and examined by Western analysis for myc-DDK-tagged MAP1LC3B expression. Quantification of Western blots was performed using ImageJ (NIH).

Studies in Patients With HIV

All studies were approved by the institutional ethics committe (IRB#00077138). Platelets used for the described studies were freshly isolated as described above from consenting patients with HIV. Patients were excluded if taking immunosuppressant medications, had concurrent infection with hepatitis C, or another acute viral or bacterial infection, for which they were actively being treated or had been treated in the last 4 weeks.

Infection Studies

DENV2 was propagated in C6/36 Aedes albopictus mosquito cells⁵⁹ and titrated by plaque assay on LCC-MK2 cells. The amount of infectious particles was expressed as plaque-forming units per milliliter. Supernatants from uninfected cell cultures (mock) were produced using the same conditions. Freshly isolated platelets (multiplicity of infection 0.2) were infected with DENV2 and incubated for 24 hours with the virus before being analyzed.

Laser Capture Microscopy

Resting-state human platelets were isolated and fixed in suspension (see above). Platelets were spun down on a membrane slide (PEN membrane glass slide; Thermo Fisher Scientific). The samples were dehydrated using increasing ethanol concentrations and a final incubation step in xylene for 5 minutes. For laser capture microscopy, we used a Veritas system (Arcturus Bioscience, MountainView, CA). The laser power of the cutting laser was set to 2.28, the capture laser was set at 70 mA, pulse length 2000 µsec, and a frequency of 10 hits. Membrane pieces were captured in macro laser capture microscopy caps (Thermo Fisher Scientific). RNA from target cells was isolated using the PicoPure RNA isolation kit (Thermo Fisher Scientific) and subsequently amplified using the RiboAmp HS PLUS Kit (Thermo Fisher Scientific). cDNA synthesis and PCR for LINE-1 ORF1 and ORF2 were performed as described above.

Microscopy and Image Analysis

Fluorescence microscopy and high-resolution confocal reflection microscopy was performed using an Olympus IX81, FV300 (Olympus, Melville, NY) confocal-scanning microscope equipped with a 60×/1.42 NA oil objective for viewing platelets. An Olympus FVS-PSU/IX2-UCB camera and scanning unit and Olympus Fluoview FV 300 image acquisition software version 5.0 were used for recording. In addition, an EVOS FL Auto Cell imaging system with integrated dual camera system, system-specific software and equipped with a 60×/1.42 NA oil objective was used. Monochrome 16-bit images were further analyzed and changes quantified using Adobe Photoshop CS6, ImageJ (NIH), and CellProfiler (www.cellprofiler.org).^60,61

Statistical Analyses

The mean±SEM was determined for each variable. Student 2-tailed t tests or ANOVA was used to identify differences among 2 or multiple experimental groups, respectively. If significant differences were found, a Newman–Keuls post-hoc procedure was used to determine the location of the difference. A 2-tailed P value <0.05 was considered significant.

Results

ERT Activity Is Present in Human Platelets

Although in nucleated cells endogenous retrotransposon-encoded RT (eRT) is essential for the mobilization of transposable elements, eRT activity has not previously been examined in human platelets. Therefore, we first determined whether human platelets possess eRT activity using a PCR-based in vitro assay.³⁷ An exogenous MS2 phage RNA is added to isolated platelet lysates, and evidence of reverse transcription is detected by probing for the DNA product of MS2 phage. We found that eRT activity is present in platelets at baseline and is retained over time (Figure 1A). Stimulating platelets with thrombin (t=6 hours) did not visibly alter eRT activity (Figure 1A, lane 5). In parallel experiments, we also confirmed that platelets in vitro transcribe an exogenously added GFP RNA, thus excluding the possibility of contaminating bacteria which are used to produce MS2 phage RNA⁶² in the PCR reagents (data not shown). Treating platelets with nevirapine, a clinically used RT inhibitor, blocked reverse transcription of exogenous MS2 phage in a dose-dependent manner (Figure 1B). Additional experiments of platelet lysates with 100 kDa size exclusion–based spin columns (Figure I in the online-only Data Supplement) suggested that LINE-1 elements could account for most of the eRT activity (ie, fully processed HERV-K RT has an MW of 66 kDa).

• Download figure
• Download PowerPoint

Human Platelets Express LINE-1 ORF1 and ORF2

Human platelets express mRNA encoding LINE-1 ORF1 and L1 ORF2 (Figure 1C and 1D). Activation of platelets did not visibly alter the expression of LINE-1 ORF1 or ORF2 (Figure 1C). We next performed in situ hybridization experiments using custom-designed probes against LINE-1 (Figure 1E). The specificity of the in situ experiments is based on the ability to detect a visible signal only if multiple probes align with their target RNA sequentially (mismatches indicated in Figure 1D are most likely artifacts introduced during the sequencing process). Consistent with our findings by PCR and Sanger sequencing (Figure 1C and 1D), we found that LINE-1 mRNA is endogenously expressed in situ in the cytoplasm of unstimulated human platelets (Figure 1E, see also Figure 1F demonstrating binding sites of primer pairs and in situ probes). Laser capture microscopy of individual human platelets further confirmed LINE-1 ORF1 and ORF2 expression (Figure II in the online-only Data Supplement). Laser capture microscopy also excludes the possibility that signals detected in the PCR experiments are derived from LINE-1 mRNA or DNA introduced by contaminating nucleated cells.

We next investigated the localization of LINE-1 encoded ORF1 (ORF1p) and ORF2p in human platelets. Both ORF1p and ORF2p are robustly expressed basally in the cytoplasm of unstimulated platelets (Figure 2A). In activated platelets, LINE-1 proteins concentrated and accumulated in the middle of the cell bodies (Figure 2A, arrows), cellular regions rich in mRNAs and ribosomal constituents.^7,8 LINE-1 proteins were also detected in megakaryocytes and proplatelet extensions (data not shown). When platelets were allowed to culture overnight (18 hours), ORF2p continued to be robustly expressed and was also identified in the cytoplasm of platelets with extended cell bodies^50,54 (Figure III in the online-only Data Supplement). Immunoblotting also demonstrated that ORF1p (Figure 2B) and ORF2p (Figure 2C) proteins were present in platelets. Specificity of the anti-ORF2p antibody was confirmed by performing a quench experiment using the immunogenic peptide (Figure 2C).

• Download figure
• Download PowerPoint

Platelets Contain RNPs Harboring L1 mRNA and L1 ORF2p

We hypothesized that RNPs in platelets contain functional LINE-1 mRNA and LINE-1 ORF2p harboring reverse transcriptase activity. Therefore, to further identify the localization and function of endogenous L1-encoded RT (eRT) in platelets, we focused on the subcellular localization of eRT. RNPs are intracellular complexes integral to the regulation of gene expression.⁶³ To examine whether the eRT expression and activity we identified (Figures 1 and 2) is contained within RNPs, we next determined whether RNPs isolated from platelets harbored reverse transcriptase activity. Purified RNPs from platelets were sufficient to reverse transcribe an exogenous MS2 phage RNA in an in vitro RT activity assay (Figure 3A), indicating that platelet eRT activity is found within RNPs. We next investigated whether the eRT activity is ORF2p (which contains the RT domain) dependent. RNP lysates used for RT activity assays were depleted of LINE-1 ORF2p using the anti-ORF2p antibody characterized in Figure 2. Immunodepletion of LINE-1 ORF2p reduced RT activity by >60% (Figure 3B), indicating that the LINE-1 ORF2p RT domain is the major source for platelet eRT. Consistent with the eRT activity associated with RNPs, RNA coding for LINE-1 ORF1 and ORF2 was identified within isolated platelet RNPs (Figure 3C). Furthermore, L1 ORF2p was confirmed in platelet-derived RNPs (Figure 3D). To confirm that platelets are capable of forming L1 RNPs, we in vitro translated T7-tagged ORF1p using the plasmid pAD2TE1²⁷ as a template. Next, isolated total platelet RNA was incubated with the recombinant T7-tagged ORF1p, and ORF1p-bound RNA was subsequently immunoprecipitated using the T7 tag. T7-tagged ORF1p specifically binds to platelet-derived LINE-1 mRNA indicating that platelets are capable of forming LINE-1 RNPs (Figure 3E). In addition, the experiments confirmed that the RNPs isolated from platelets (Figure 3A) are composed of LINE-1 encoding mRNAs and encoded proteins. After identifying that the major source of eRT activity in platelets is the L1 ORF2p RT domain in isolated RNPs, we next sought to determine the function of eRT activity in platelets.

• Download figure
• Download PowerPoint

ERT in Platelets Alters Cytoskeletal Dynamics, Promotes Prothrombotic Functional Responses In Vivo, and Regulates Global Protein Synthesis

Previous studies by our group and others^50,54 demonstrated that cytoskeletal reorganization can promote the formation of extended platelets with ≥2 cell bodies, a process termed progeny formation that resembles how megakaryocytes form new platelets. In tumor cells, inhibition of eRT activity induces cellular differentiation,^37,40 a process that also regulates cytoskeletal events. Therefore, we hypothesized that platelet eRT activity regulates platelet progeny formation; morphological changes in human platelets orchestrated by cytoskeletal dynamics. When platelet eRT activity was inhibited with nevirapine (an RT inhibitor used to treat people with HIV), at doses similar to concentrations seen in treated patients, the number of newly formed cell bodies that extended from cultured platelets significantly increased (Figure 4A).

• Download figure
• Download PowerPoint

Platelet cytoskeletal reorganization and progeny formation can result in platelet activation.⁵⁰ We next sought to determine whether platelet eRT activity regulated functional responses and thrombosis. We first stimulated platelets pre-treated in vitro with nevirapine (or its vehicle control) with thrombin. Inhibition of platelet eRT activity with nevirapine increased activated integrin αIIbβ3 expression on the platelet surface (Figure 4B). To establish whether nevirapine regulated thrombosis in vivo, we first confirmed that similar to human platelets, murine platelets possess eRT activity (Figure IV in the online-only Data Supplement). In a well-established pulmonary thrombosis model,⁵² which is platelet dependent, nevirapine significantly accelerated thrombosis-dependent mortality (Figure 4C and 4D). To determine the clinical relevance of these findings, we examined activation of integrin αIIbβ3 in platelets isolated from people with HIV treated with RT inhibitors clinically and matched healthy controls. As shown in Figure 4E, unstimulated platelets from people with HIV had significantly increased basal activation of integrin αIIbβ3, thus recapitulating our in vitro findings (Figure 4B).

On the basis of these in vitro and in vivo results and observations⁵⁰ that platelet cytoskeletal events require protein synthesis, we next determined whether eRT activity regulates de novo protein synthesis. We performed metabolic labeling by incubating platelets with Click-IT L-azidohomoalanine⁵⁰ in the presence or absence of nevirapine. Inhibiting eRT activity significantly increased the incorporation of labeled L-azidohomoalanine into platelets (Figure 4F). The specificity of eRT-regulated translation in platelets was demonstrated by using puromycin (a translational inhibitor) as a control (Figure 4F). These data indicate that eRT activity in platelets regulates protein synthetic events.

To establish the relevance of platelet eRT activity in human disease, we examined the activity and function of eRT in platelets isolated from people with HIV. We confirmed, similar to our observations in platelets from healthy subjects, that platelets from people with HIV (with undetectable viral load) possess eRT activity (data not shown). Next, we incubated platelets isolated from healthy donors or a person with HIV treated with an RT inhibitor with [³⁵S]methionine and [³⁵S]cysteine. Compared with a healthy control subject, protein synthesis was increased in a person with HIV treated clinically with an RT inhibitor (Figure VA in the online-only Data Supplement). Increased protein synthesis was also observed when platelets from a healthy donor were treated with nevirapine ex vivo (Figure VB in the online-only Data Supplement). Furthermore, platelets from people with HIV on ART demonstrated dramatically increased morphological changes (Figure 4G) that require cytoskeletal reorganization.

RNA–DNA Hybrids Are Present in Human Platelets

As our findings suggest that platelet eRT activity controls translational events, we hypothesized that one function of eRT in platelets is to generate RNA–DNA hybrids, resulting in a translational block (Graphic Abstract). We identified RNA–DNA hybrids in human platelets in situ (Figure 5A and 5B). We next determined the mechanisms controlling RNA–DNA hybrid formation. In freshly isolated platelets from healthy control subjects, RNA–DNA hybrids were present in 6.6±3.2% of the cells. When platelets were incubated overnight, the percentage of hybrid-positive cells increased to 20.0±1.6% (Figure 5; P<0.05). This increase in hybrid formation was RT dependent because the treatment of platelets with nevirapine reduced hybrid-positive cells (11.1±2.9%; Figure 5; P<0.05). To demonstrate the specificity of the antibody-based hybrid detection, we treated platelets with DNase and RNase A in a low-concentration NaCl buffer, conditions favoring the digestion of DNA or RNA in RNA–DNA hybrids. As expected, both DNase and RNase A significantly reduced hybrid formation (Figure 5). In contrast, using a high concentration of NaCl in combination with RNase A (conditions under which hybrids are not digested) did not decrease hybrid formation.

• Download figure
• Download PowerPoint

Yoshida et al⁶⁴ also used exogenous MS2 phage RNA to examine RT activity in washed platelet extracts from patients with myeloproliferative neoplasms. They speculated that RT activity may be found in mitochondria. While not a primary focus of our studies, in additional control experiments, we stained platelets with mitotracker to detect mitochondria, and the anti-RNA–DNA hybrid antibody in parallel, correlating potential intramitochondrial transcription events resulting in cotranscriptional RNA–DNA hybrid formation. Although some costaining could be detected in platelet mitochondria, ≈50% of the hybrid signals were independent of mitochondrial staining (data not shown). Next, we compared the RNA–DNA hybrid expression levels between platelets isolated from people with HIV before initiation of ART and platelets isolated from people with HIV after treatment with RT inhibitor–based ART. Platelets from people with HIV had reduced numbers of RNA–DNA hybrids, compared with platelets from people with HIV not being treated with RT inhibitor–based ART (Figure 5C and 5D).

To identify candidates regulated by RNA–DNA hybrids, we immunoprecipitated hybrids from platelet lysates from healthy control subjects. RNA–DNA hybrids were isolated, a cDNA library of these RNAs was created, and sequencing was performed. Sequence analysis of the cDNA library revealed the enrichment of several target RNAs (Table I in the online-only Data Supplement). Three of the enriched identified RNAs coded for MAP1LC3B (microtubule-associated protein 1 light chain 3 β), SELP (P-selectin, which regulates platelet activation), and RPL26 (ribosomal protein L26, which regulates gene expression; Figure 6A). MAP1LC3B mediates autophagy,^65,66 and autophagy has been linked to platelet activation.⁶⁷ Accordingly, we focused on validating the presence of MAP1LC3B nucleotide sequences. Enrichment of MAP1LC3B sequences within RNA–DNA hybrids was confirmed in subsequent IP and qPCR experiments (Figure 6B). Thus, MAP1LC3B mRNA is expressed within RNA–DNA hybrids in platelets.

• Download figure
• Download PowerPoint

LINE-1 ORF1p Interacts With MAP1LC3B RNA in Trans

To determine if MAP1LC3B mRNA can be a substrate for LINE-1 ORF1p and ORF2p, we in vitro translated T7-tagged ORF1p from the expression plasmid pAD2TE1²⁷ as a template (Figure 3E). Platelet RNA was incubated with the recombinant T7-tagged ORF1p and immunoprecipitated using an anti-T7 tag antibody. ORF1p binds to platelet-derived MAP1LC3B mRNA (Figure 6C) indicating that this mRNA is associated with LINE-1 RNPs and would, therefore, be accessible to the RT domain of LINE-1 ORF2p.

RNA–DNA Hybrids Regulate Protein Synthetic Events in Human Platelets

We next in vitro transcribed an MAP1LC3B-myc-DDK-tag encoding plasmid, generating an mRNA template for a modified in vitro RT activity assay and allowing us to specifically detect the translated MAP1LC3B fusion protein. Some platelet lysates used in the RT activity assay as RT donor were treated with the RT inhibitor nevirapine to block hybrid formation. In addition, select samples underwent a melting step, resulting in a separation of RNA–DNA hybrids and releasing the translational block. The cDNA/hybrids were in vitro translated, and the resulting proteins were separated by SDS-PAGE using a myc-DDK tag antibody for detection of in vitro translated proteins. The bar graph (Figure 6D) demonstrates that inhibiting hybrid formation (either by nevirapine or by inducing melting of the RNA from the DNA) increased the synthesis of MAP1LC3B protein. As these data suggest that MAP1LC3B synthesis in platelets may be translationally controlled, at least in part, by RNA–DNA hybrids, we next examined MAP1LC3B expression in live platelets pre-treated with nevirapine. Nevirapine significantly increased total MAP1LC3B protein (LC3B I and LC3B II) in platelets (Figure 6E). Similar findings were observed with 2 other proteins: P-selectin and ribosomal protein L26 (Figure VIA and VIB in the online-only Data Supplement). P-selectin surface translocation to the platelet surface was also increased in people with HIV treated with RT inhibitors (Figure VIC in the online-only Data Supplement). These data indicate that nevirapine inhibits RNA–DNA hybrid formation and enhances protein synthesis by releasing a translational block.

Discussion

Platelets are anucleate and traditionally viewed as having a fixed molecular signature and associated functional responses. Nevertheless, platelets use an ever-increasing, and often unexpected, repertoire of mechanisms to regulate their transcriptional and proteomic signature in health and disease.² Here, we provide the first evidence that human platelets possess LINE-1–derived eRT activity, regulating platelet morphology and protein synthesis, and leading to prothrombotic functional responses in vitro and in vivo. We also demonstrate that these findings are concordantly observed in people with HIV clinically treated with RT inhibitors.

Both LINE-1 ORF1p (RNA binding) and ORF2p (endonuclease and RT domain) are encoded by the bicistronic LINE-1 and expressed in platelets. Concordant with the detected expression of both LINE-1 proteins, we discovered that platelets possess eRT activity (Figure 1). Previous studies have demonstrated the importance of LINE-1 RNPs,^27,30,53 intracellular complexes that are integral to the regulation of gene expression⁶³ and for retrotransposition in other cell types. Consistent with this, we report that the majority of platelet eRT activity is localized to LINE-1 RNPs (Figure 3). Depleting LINE-1 ORF2p from platelet RNPs demonstrates that LINE-1 RNPs are the major (eg, ≈60% of greater) contributor to platelet eRT activity. Furthermore, we show that exogenously expressed LINE-1 ORF1p containing an epitope tag (T7) at the carboxy terminus binds selectively to its endogenous encoding RNA (cis-preference³⁰) in platelets. These findings indicate that human platelets contain functional LINE-1 RNPs. When platelets were incubated on immobilized fibrinogen and stimulated with thrombin, we observed trafficking of the LINE-1 proteins toward the central areas of platelets (Figure 2), subcellular regions known to be rich in mRNAs and ribosomal constituents.^7,8 This shift in localization would allow LINE-1 proteins to interact with endogenous mRNAs that code for other cellular proteins (transacting LINE-1), a concept evaluated in previous studies.³⁰

Because LINE-1 ORF2p includes an RT domain, it is worth discussing the functions of RT enzymes. In biochemical in vitro assays, RTs are used to reverse transcribe mRNA into cDNA to enable the subsequent PCR amplification step. This reaction forms mRNA–cDNA hybrids. Here, we demonstrate that platelets dynamically express RNA–DNA hybrids. Hybrid expression was dependent on eRT (ORF2p), and hybrid formation was blocked by nevirapine at doses achieving concentrations relevant to patients treated with this drug.

On the basis of our findings, we propose a previously unrecognized cellular mechanism. In our model, eRT in platelets generates RNA–DNA hybrids that block translation by partially reverse transcribing mRNA (Graphic Abstract). The cellular concept of intentionally stalling translation was used in molecular biology strategies as an in vitro technique to identify specifically translated mRNAs,^42,43 but to date has not been identified as an actively used translational control mechanism in primary human cells. In contrast, it is a well-accepted concept that the stability of cotranscriptional RNA–DNA hybrids affects transcriptional efficiency⁴⁴ and even that stability differs between coding and noncoding regions.⁶⁸ However, this transcriptional mechanism is not based on eRT utilization. Nevertheless, in 2013, Sciamanna et al⁷⁰ suggested that the regulation of tumor cell biology by LINE-1,^36,37,39,70 an area of intense research, could be induced by the formation of RNA–DNA hybrids. Using CsCl density gradients, they selectively identified Alu and LINE-1 containing RNA–DNA hybrid molecules in cancer but not in normal cells. They concluded that LINE-1–mediated RNA–DNA hybrids would interfere with the formation of dsRNA and, therefore, the synthesis of regulatory small RNAs.⁶⁹

Our findings demonstrate that RNA–DNA hybrid formation regulates synthesis of specific candidate RNAs by the induction of a translational block. This is supported directly by protein de novo synthesis assays, but also indirectly by the formation of platelet progeny, a process strictly dependent on protein synthetic activity.⁵⁰MAP1LC3B was identified as one of the target mRNAs of transacting L1 ORF1p. MAP1LC3B plays an important role in autophagic processes^65,66 and serves as a good autophagy marker.⁷¹ In addition, this catabolic process maintaining cellular hemostasis, adaptation to starvation, development, and pathogen elimination needs to be tightly regulated.⁷² Therefore, the translational control of one of the major players in autophagy by RNA–DNA hybrid formation is an attractive focus of future research. Two other identified hybrids also underscore the importance of this novel regulatory pathway. RPL26 is important for ribosomal hemostasis and regulation of gene expression, whereas SELP (P-selectin) is one of the major α-granular constituents being translocated to the surface of activated platelets on stimulation.⁷³

This novel mechanism for translational control has clinical implications. As part of ART, patients with HIV are typically prescribed RT inhibitor–based therapy. In people with HIV, the introduction of ART has dramatically improved life expectancy.⁴⁶ As a result, chronic and often accelerated disorders, including atherothrombosis,^47–49 are replacing opportunistic infections as important causes of morbidity and mortality.⁷⁴ Furthermore, in patients with HIV under ART, and despite undetectable virus levels, a 30-fold increase in mortality when compared with uninfected controls could be demonstrated. The increased mortality was attributed to ongoing innate immune responses and activation of coagulation factors.^75–77

We demonstrated that platelet eRT activity regulates integration activation in vitro and in vivo. Similar findings of platelet integrin activation were observed in people with HIV prescribed ARTs that include RT inhibitors. We postulate that inhibition of platelet eRT activity may contribute to the increased risk of thrombosis observed in people with HIV.⁷⁸ Furthermore, because we detected LINE-1 expression in other primary human blood cells, including megakaryocytes and T cells (Figure VIII in the online-only Data Supplement), our findings may have implications not only in the megakaryocyte–platelet axis but also in other cell lineages.

Platelets isolated from people with HIV were more synthetically active (Figure V in the online-only Data Supplement) and had altered morphology resembling dumbbells (Figure 4C, as seen in vitro with nevirapine treated platelets), suggesting deregulated translational control mechanisms. Consistent with these observations, hybrids were higher in platelets from patients with HIV not treated with ART than compared with healthy individuals or people with HIV treated with ART. Our findings suggest that administration of ART to people with HIV alters platelet protein synthesis by lifting the RNA–DNA hybrid-induced translational block, although we cannot exclude the possibility that differences in RNA–DNA hybrids in people with HIV was also induced by HIV encoded RT. In this context, it is also interesting to note that platelets contain dengue virus DNA when infected with dengue virus, a (+)ssRNA virus (Figure VII in the online-only Data Supplement). Dengue virus DNA is not part of the virus life cycle, and these data suggest a reverse transcription event. Furthermore, when eRT was inhibited, dengue DNA could not be detected. One might speculate if inhibiting dengue DNA formation removes an RNA–DNA hybrid-induced translational block, leading to increased dengue virus replication.

Although our findings confirm and extend prior studies in murine cells and tumor lines,^37,39,79 we recognize that several reports did not confirm that nevirapine blocks LINE-1 RT.⁸⁰ There are several potential explanations for these seemingly contradictory findings. First, we used higher concentrations of nevirapine (750 µmol/L), specifically chosen to recapitulate systemic concentrations of nevirapine achieved clinically. Second, we did not use tumor cell lines, but primary human cells (eg, platelets). Finally, we examined RNA–DNA hybrid formation, rather than retrotransposition events. We also identified that another RT inhibitor, delavirdine, similarly blocked eRT activity (data not shown), indicating that our findings are not confined to nevirapine alone. Although size exclusion experiments (Figure I in the online-only Data Supplement) did not completely exclude the possibility of eRT activity deriving from proviral insertions of human endogenous retroviruses, the fully processed HERV-K RT has a molecular weight of 66 kDa, making this unlikely.

In conclusion, our data identify a previously unrecognized function for LINE-1–encoded proteins. We propose a model whereby endogenous LINE-1–mediated RNA–DNA hybrid formation controls protein expression for select mRNAs (Graphic Abstract). Because LINE-1 is classically considered to be involved in disease inducing de novo disruption of gene expression by retrotransposition events,³⁵ or tumor genesis,^81,82 our findings also demonstrate that in human platelets, LINE-1 functions in a newly described constructive and potentially regulated fashion. Finally, our results provide evidence for a new translational regulatory mechanism that is present in platelets and which regulates integrin activation and thrombosis.

Acknowledgments

We thank J.V. Moran for providing the pAD2TE plasmid. We thank Chris K. Rodesch and Keith R. Carney of the University of Utah Cell Imaging Core for technical assistance. We also thank Diana Lim for preparation of the figures, critical comments, and consultation on effective display of the images.

Footnotes